Incidental Mutation 'R5845:Als2cr12'
ID453545
Institutional Source Beutler Lab
Gene Symbol Als2cr12
Ensembl Gene ENSMUSG00000047528
Gene Nameamyotrophic lateral sclerosis 2 chromosome region 12
Synonyms4933425F06Rik, 4933405P16Rik
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58646903-58695989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58667778 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 243 (E243D)
Ref Sequence ENSEMBL: ENSMUSP00000139420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055313] [ENSMUST00000188772] [ENSMUST00000191252] [ENSMUST00000191565]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055313
AA Change: E243D

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062497
Gene: ENSMUSG00000047528
AA Change: E243D

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
coiled coil region 276 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185953
Predicted Effect possibly damaging
Transcript: ENSMUST00000188772
AA Change: E243D

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140780
Gene: ENSMUSG00000047528
AA Change: E243D

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191252
Predicted Effect possibly damaging
Transcript: ENSMUST00000191565
AA Change: E243D

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139420
Gene: ENSMUSG00000047528
AA Change: E243D

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
coiled coil region 276 359 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Als2cr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Als2cr12 APN 1 58670394 missense probably damaging 0.98
IGL02549:Als2cr12 APN 1 58659282 missense probably benign 0.05
IGL02647:Als2cr12 APN 1 58670454 missense probably benign
IGL03098:Als2cr12 UTSW 1 58691749 missense probably benign 0.06
PIT4504001:Als2cr12 UTSW 1 58659099 missense probably benign 0.20
R1147:Als2cr12 UTSW 1 58669463 missense probably damaging 0.99
R1147:Als2cr12 UTSW 1 58669463 missense probably damaging 0.99
R1959:Als2cr12 UTSW 1 58659278 missense possibly damaging 0.92
R1960:Als2cr12 UTSW 1 58659278 missense possibly damaging 0.92
R3815:Als2cr12 UTSW 1 58659005 missense probably damaging 0.98
R4445:Als2cr12 UTSW 1 58666921 missense possibly damaging 0.83
R4617:Als2cr12 UTSW 1 58661442 missense probably benign 0.19
R4720:Als2cr12 UTSW 1 58678348 missense possibly damaging 0.46
R4816:Als2cr12 UTSW 1 58670408 missense probably benign 0.10
R4947:Als2cr12 UTSW 1 58676539 missense probably benign 0.05
R4960:Als2cr12 UTSW 1 58667806 missense probably damaging 0.98
R4970:Als2cr12 UTSW 1 58659282 missense probably benign 0.05
R5018:Als2cr12 UTSW 1 58690950 missense probably benign
R5112:Als2cr12 UTSW 1 58659282 missense probably benign 0.05
R5269:Als2cr12 UTSW 1 58691760 missense possibly damaging 0.83
R5426:Als2cr12 UTSW 1 58666886 nonsense probably null
R5541:Als2cr12 UTSW 1 58658429 missense probably benign 0.03
R5863:Als2cr12 UTSW 1 58691749 missense probably benign 0.06
R6364:Als2cr12 UTSW 1 58658372 missense probably damaging 0.96
R6430:Als2cr12 UTSW 1 58678289 missense probably damaging 0.98
R6527:Als2cr12 UTSW 1 58692413 start codon destroyed probably null 0.01
R6573:Als2cr12 UTSW 1 58666844 missense probably benign 0.27
R7367:Als2cr12 UTSW 1 58666864 missense probably benign 0.07
R7459:Als2cr12 UTSW 1 58691752 missense possibly damaging 0.46
R7497:Als2cr12 UTSW 1 58678308 missense probably damaging 1.00
R8317:Als2cr12 UTSW 1 58676548 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTTTCCTGTAACCTGAGGCACC -3'
(R):5'- TCAGCAAGGCCCAAGTTAGG -3'

Sequencing Primer
(F):5'- CTGAGGCACCTTTCATTCAGAAG -3'
(R):5'- TTAGGGGAGAGCAACGCC -3'
Posted On2017-02-10