Incidental Mutation 'R5845:Sept2'
ID453548
Institutional Source Beutler Lab
Gene Symbol Sept2
Ensembl Gene ENSMUSG00000026276
Gene Nameseptin 2
SynonymsNedd5
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93478964-93510260 bp(+) (GRCm38)
Type of Mutationunclassified (5 bp from exon)
DNA Base Change (assembly) T to A at 93499035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027495] [ENSMUST00000112912] [ENSMUST00000129211] [ENSMUST00000131175] [ENSMUST00000136182] [ENSMUST00000142401] [ENSMUST00000149532] [ENSMUST00000150931] [ENSMUST00000153826] [ENSMUST00000168776] [ENSMUST00000172165] [ENSMUST00000179353]
Predicted Effect probably damaging
Transcript: ENSMUST00000027495
AA Change: I122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027495
Gene: ENSMUSG00000026276
AA Change: I122N

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112912
AA Change: I122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108534
Gene: ENSMUSG00000026276
AA Change: I122N

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129211
AA Change: I122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120511
Gene: ENSMUSG00000026276
AA Change: I122N

DomainStartEndE-ValueType
Pfam:Septin 34 213 4.9e-85 PFAM
Pfam:AIG1 38 131 9.9e-7 PFAM
Pfam:MMR_HSR1 39 211 1.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131175
AA Change: I122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120694
Gene: ENSMUSG00000026276
AA Change: I122N

DomainStartEndE-ValueType
Pfam:Septin 34 212 6.5e-85 PFAM
Pfam:AIG1 38 131 9.8e-7 PFAM
Pfam:MMR_HSR1 39 211 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136182
AA Change: I82N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118621
Gene: ENSMUSG00000026276
AA Change: I82N

DomainStartEndE-ValueType
Pfam:AIG1 1 96 1.4e-6 PFAM
Pfam:MMR_HSR1 1 103 1.3e-8 PFAM
Pfam:Septin 1 107 6.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142401
AA Change: I152N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121974
Gene: ENSMUSG00000026276
AA Change: I152N

DomainStartEndE-ValueType
Pfam:Septin 64 177 4.9e-49 PFAM
Pfam:AIG1 68 159 2.3e-7 PFAM
Pfam:MMR_HSR1 69 172 1.1e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149532
SMART Domains Protein: ENSMUSP00000115536
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 120 7e-35 PFAM
Pfam:GTP_EFTU 37 110 9.5e-6 PFAM
Pfam:AIG1 38 120 3.4e-7 PFAM
Pfam:Ras 39 115 1.2e-5 PFAM
Pfam:MMR_HSR1 39 118 2.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150931
AA Change: I122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117517
Gene: ENSMUSG00000026276
AA Change: I122N

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152778
Predicted Effect probably benign
Transcript: ENSMUST00000153826
SMART Domains Protein: ENSMUSP00000114614
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 77 4.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168776
AA Change: I122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132850
Gene: ENSMUSG00000116048
AA Change: I122N

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.4e-129 PFAM
Pfam:MMR_HSR1 39 240 1.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172165
AA Change: I82N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127276
Gene: ENSMUSG00000116048
AA Change: I82N

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 203 5.8e-8 PFAM
Pfam:Septin 1 273 1.5e-125 PFAM
coiled coil region 277 308 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179353
AA Change: I122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136366
Gene: ENSMUSG00000116048
AA Change: I122N

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Meta Mutation Damage Score 0.9449 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Sept2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Sept2 APN 1 93499142 missense probably damaging 1.00
IGL01909:Sept2 APN 1 93499101 missense probably damaging 1.00
IGL02504:Sept2 APN 1 93500481 missense probably benign 0.06
R0136:Sept2 UTSW 1 93507050 missense possibly damaging 0.57
R0140:Sept2 UTSW 1 93501639 missense probably damaging 1.00
R0335:Sept2 UTSW 1 93495599 missense probably damaging 1.00
R0538:Sept2 UTSW 1 93501623 missense probably damaging 1.00
R1370:Sept2 UTSW 1 93499106 missense probably damaging 1.00
R1463:Sept2 UTSW 1 93499315 missense possibly damaging 0.79
R4832:Sept2 UTSW 1 93499127 missense probably damaging 0.98
R5443:Sept2 UTSW 1 93497452 missense possibly damaging 0.95
R5898:Sept2 UTSW 1 93479301 missense probably benign
R6122:Sept2 UTSW 1 93497376 missense probably damaging 1.00
R6542:Sept2 UTSW 1 93497466 critical splice donor site probably null
R7784:Sept2 UTSW 1 93497444 missense probably damaging 1.00
R8074:Sept2 UTSW 1 93505561 missense probably benign
R8266:Sept2 UTSW 1 93501526 missense possibly damaging 0.91
R8277:Sept2 UTSW 1 93499308 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCCCACGATTACTATTGAAATTTGT -3'
(R):5'- TGCCACACATTTAGGGAAAGC -3'

Sequencing Primer
(F):5'- AGATGACTGTGAGCATCCACTTCTG -3'
(R):5'- TTTAGGGAAAGCATAGAAACATACC -3'
Posted On2017-02-10