Incidental Mutation 'R5845:Kcnk2'
ID453550
Institutional Source Beutler Lab
Gene Symbol Kcnk2
Ensembl Gene ENSMUSG00000037624
Gene Namepotassium channel, subfamily K, member 2
SynonymsTREK-1
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location189207930-189402273 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 189277721 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079451] [ENSMUST00000110920] [ENSMUST00000180044] [ENSMUST00000192723] [ENSMUST00000193319] [ENSMUST00000194172] [ENSMUST00000194402]
Predicted Effect probably benign
Transcript: ENSMUST00000079451
SMART Domains Protein: ENSMUSP00000078416
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 197 2e-20 PFAM
low complexity region 221 230 N/A INTRINSIC
Pfam:Ion_trans_2 233 313 6.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110920
SMART Domains Protein: ENSMUSP00000106545
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180044
SMART Domains Protein: ENSMUSP00000136513
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191699
Predicted Effect probably benign
Transcript: ENSMUST00000192723
SMART Domains Protein: ENSMUSP00000141849
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193319
SMART Domains Protein: ENSMUSP00000141891
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 198 2.5e-21 PFAM
Pfam:Ion_trans_2 226 313 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194172
SMART Domains Protein: ENSMUSP00000142176
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 5e-20 PFAM
low complexity region 216 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194402
SMART Domains Protein: ENSMUSP00000142026
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 1.4e-19 PFAM
Pfam:Ion_trans_2 222 309 2.2e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the two-pore-domain background potassium channel protein family. This type of potassium channel is formed by two homodimers that create a channel that leaks potassium out of the cell to control resting membrane potential. The channel can be opened, however, by certain anesthetics, membrane stretching, intracellular acidosis, and heat. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased sensitivity to pharmacologically induced seizures and ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Kcnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnk2 APN 1 189243014 missense probably damaging 0.96
IGL01100:Kcnk2 APN 1 189339936 missense probably damaging 1.00
IGL01872:Kcnk2 APN 1 189256583 missense probably damaging 1.00
IGL01929:Kcnk2 APN 1 189340030 missense probably damaging 1.00
IGL02643:Kcnk2 APN 1 189258779 missense possibly damaging 0.63
IGL03056:Kcnk2 APN 1 189295711 missense possibly damaging 0.82
IGL03340:Kcnk2 APN 1 189295681 missense possibly damaging 0.51
R0041:Kcnk2 UTSW 1 189295691 missense probably benign 0.44
R0041:Kcnk2 UTSW 1 189295691 missense probably benign 0.44
R0279:Kcnk2 UTSW 1 189209972 missense possibly damaging 0.58
R0569:Kcnk2 UTSW 1 189339801 missense probably damaging 1.00
R0645:Kcnk2 UTSW 1 189256730 intron probably null
R1070:Kcnk2 UTSW 1 189256763 splice site probably benign
R1449:Kcnk2 UTSW 1 189340026 missense probably benign 0.31
R2401:Kcnk2 UTSW 1 189340017 missense possibly damaging 0.64
R4418:Kcnk2 UTSW 1 189256727 missense probably damaging 1.00
R4923:Kcnk2 UTSW 1 189339936 missense probably damaging 1.00
R5782:Kcnk2 UTSW 1 189256579 missense probably damaging 1.00
R6140:Kcnk2 UTSW 1 189209907 missense probably damaging 0.97
R6240:Kcnk2 UTSW 1 189242982 missense probably damaging 1.00
R6881:Kcnk2 UTSW 1 189209990 missense probably benign 0.00
R8046:Kcnk2 UTSW 1 189258736 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATCGGCGTCGTCTTCATCG -3'
(R):5'- TGTACACAGCTCTTATCATCGAAC -3'

Sequencing Primer
(F):5'- GCGTCGTCTTCATCGGAGTC -3'
(R):5'- CGAAGAACTTGAGGCGC -3'
Posted On2017-02-10