Incidental Mutation 'R5845:Olfr1129'
ID453552
Institutional Source Beutler Lab
Gene Symbol Olfr1129
Ensembl Gene ENSMUSG00000062272
Gene Nameolfactory receptor 1129
SynonymsGA_x6K02T2Q125-49078087-49079031, MOR264-9P, MOR264-23
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87573902-87577259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87576023 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 313 (I313T)
Ref Sequence ENSEMBL: ENSMUSP00000150986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081034] [ENSMUST00000213315] [ENSMUST00000214773]
Predicted Effect probably benign
Transcript: ENSMUST00000081034
AA Change: I313T

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079823
Gene: ENSMUSG00000062272
AA Change: I313T

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 6e-53 PFAM
Pfam:7tm_1 47 296 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213315
AA Change: I313T

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000214773
AA Change: I313T

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Olfr1129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Olfr1129 APN 2 87575174 missense probably damaging 1.00
IGL01731:Olfr1129 APN 2 87575938 missense probably benign 0.26
IGL01819:Olfr1129 APN 2 87575479 missense probably damaging 1.00
IGL01995:Olfr1129 APN 2 87575462 missense probably damaging 1.00
IGL02280:Olfr1129 APN 2 87575345 missense probably damaging 0.98
IGL02451:Olfr1129 APN 2 87575232 missense probably benign 0.02
IGL02514:Olfr1129 APN 2 87575193 missense probably benign
IGL03039:Olfr1129 APN 2 87575192 missense probably benign 0.01
IGL03074:Olfr1129 APN 2 87575336 missense possibly damaging 0.66
R0396:Olfr1129 UTSW 2 87575567 missense possibly damaging 0.95
R0960:Olfr1129 UTSW 2 87575935 missense probably benign 0.44
R1955:Olfr1129 UTSW 2 87576005 missense probably damaging 1.00
R2006:Olfr1129 UTSW 2 87575192 missense probably benign 0.01
R3752:Olfr1129 UTSW 2 87575713 missense probably benign
R4546:Olfr1129 UTSW 2 87575186 missense probably benign 0.03
R4812:Olfr1129 UTSW 2 87575743 missense probably benign 0.11
R5327:Olfr1129 UTSW 2 87575699 missense probably damaging 1.00
R6057:Olfr1129 UTSW 2 87576019 missense probably benign
R6087:Olfr1129 UTSW 2 87575915 missense probably benign 0.43
R6125:Olfr1129 UTSW 2 87575246 missense probably benign 0.01
R6496:Olfr1129 UTSW 2 87575116 missense probably damaging 1.00
R6805:Olfr1129 UTSW 2 87574918 splice site probably null
R6967:Olfr1129 UTSW 2 87575513 missense possibly damaging 0.50
R7286:Olfr1129 UTSW 2 87575519 missense probably benign 0.00
R7296:Olfr1129 UTSW 2 87575708 missense probably damaging 1.00
R7496:Olfr1129 UTSW 2 87575371 missense probably damaging 1.00
R7753:Olfr1129 UTSW 2 87575797 missense probably benign 0.16
Z1088:Olfr1129 UTSW 2 87575680 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTGAAGTTGCCAACAGCCAC -3'
(R):5'- TTAGCAACTCACTCAACATCCATTG -3'

Sequencing Primer
(F):5'- AGGACGGGCAAAAGCCTTCTC -3'
(R):5'- GGCTATTACTCAAAGCAGCATAGGC -3'
Posted On2017-02-10