Incidental Mutation 'R5845:Tmem131l'
ID453555
Institutional Source Beutler Lab
Gene Symbol Tmem131l
Ensembl Gene ENSMUSG00000033767
Gene Nametransmembrane 131 like
SynonymsD930015E06Rik
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83897655-84040175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83940553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 335 (V335A)
Ref Sequence ENSEMBL: ENSMUSP00000049808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052342] [ENSMUST00000191758] [ENSMUST00000192095]
Predicted Effect probably damaging
Transcript: ENSMUST00000052342
AA Change: V335A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049808
Gene: ENSMUSG00000033767
AA Change: V335A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:TMEM131_like 91 174 5.8e-20 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191758
AA Change: V335A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141438
Gene: ENSMUSG00000033767
AA Change: V335A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 9.2e-10 PFAM
Pfam:DUF3651 285 362 1.5e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192095
AA Change: V335A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141607
Gene: ENSMUSG00000033767
AA Change: V335A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 8.8e-10 PFAM
Pfam:DUF3651 285 362 1.4e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 989 996 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194522
Meta Mutation Damage Score 0.1687 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Tmem131l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tmem131l APN 3 83942500 missense probably damaging 0.99
IGL00777:Tmem131l APN 3 83899290 missense probably damaging 1.00
IGL01400:Tmem131l APN 3 83922122 missense probably damaging 0.99
IGL01642:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL01796:Tmem131l APN 3 83938055 nonsense probably null
IGL02055:Tmem131l APN 3 83910366 splice site probably null
IGL02269:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL02806:Tmem131l APN 3 83928816 splice site probably benign
IGL03308:Tmem131l APN 3 83940902 missense probably benign 0.00
IGL03345:Tmem131l APN 3 83961589 missense probably damaging 1.00
R0106:Tmem131l UTSW 3 83934815 splice site probably benign
R0112:Tmem131l UTSW 3 83940587 nonsense probably null
R0212:Tmem131l UTSW 3 83913268 missense probably benign 0.19
R0328:Tmem131l UTSW 3 83921931 splice site probably benign
R0412:Tmem131l UTSW 3 84031648 missense probably damaging 1.00
R0544:Tmem131l UTSW 3 83898546 missense probably damaging 1.00
R0676:Tmem131l UTSW 3 83934815 splice site probably benign
R0815:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R0826:Tmem131l UTSW 3 83898417 missense probably damaging 1.00
R1432:Tmem131l UTSW 3 83928714 missense probably damaging 1.00
R1582:Tmem131l UTSW 3 83931783 missense probably damaging 0.99
R1591:Tmem131l UTSW 3 83940889 critical splice donor site probably null
R1804:Tmem131l UTSW 3 83910479 missense possibly damaging 0.72
R1875:Tmem131l UTSW 3 83905076 nonsense probably null
R1955:Tmem131l UTSW 3 83961544 missense probably damaging 1.00
R2049:Tmem131l UTSW 3 83942788 missense probably damaging 1.00
R2125:Tmem131l UTSW 3 83942751 critical splice donor site probably null
R2173:Tmem131l UTSW 3 83926145 missense probably damaging 1.00
R2321:Tmem131l UTSW 3 83936023 missense probably damaging 0.98
R2407:Tmem131l UTSW 3 83922048 missense probably benign 0.25
R2917:Tmem131l UTSW 3 83937580 nonsense probably null
R3082:Tmem131l UTSW 3 83909150 critical splice donor site probably null
R3086:Tmem131l UTSW 3 83931739 missense probably benign 0.00
R3773:Tmem131l UTSW 3 83898586 missense probably damaging 1.00
R3921:Tmem131l UTSW 3 83940601 missense possibly damaging 0.68
R3953:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3954:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3956:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R4118:Tmem131l UTSW 3 83960767 missense probably benign 0.00
R4700:Tmem131l UTSW 3 83899212 missense probably benign
R4862:Tmem131l UTSW 3 83898210 splice site probably benign
R4941:Tmem131l UTSW 3 83899239 missense probably benign 0.03
R5101:Tmem131l UTSW 3 83937504 missense probably damaging 0.96
R5290:Tmem131l UTSW 3 83899265 missense probably benign 0.30
R5501:Tmem131l UTSW 3 83926128 missense probably damaging 1.00
R5813:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R5973:Tmem131l UTSW 3 83922246 missense possibly damaging 0.95
R6119:Tmem131l UTSW 3 83898382 missense probably damaging 1.00
R6241:Tmem131l UTSW 3 83922164 missense probably benign 0.06
R6278:Tmem131l UTSW 3 83942491 missense possibly damaging 0.93
R6490:Tmem131l UTSW 3 83913280 missense possibly damaging 0.67
R6502:Tmem131l UTSW 3 83922408 missense probably damaging 1.00
R6503:Tmem131l UTSW 3 83940944 missense probably benign 0.26
R6868:Tmem131l UTSW 3 83961631 missense probably damaging 0.99
R7104:Tmem131l UTSW 3 83919459 missense possibly damaging 0.68
R7736:Tmem131l UTSW 3 83940568 missense probably damaging 0.97
R7885:Tmem131l UTSW 3 83910417 missense possibly damaging 0.89
R8085:Tmem131l UTSW 3 83927131 missense possibly damaging 0.81
Z1177:Tmem131l UTSW 3 84040093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTGGTTTACAGGAACAAAACC -3'
(R):5'- TGTCCCTTGATTGAGCACCC -3'

Sequencing Primer
(F):5'- TGGTTTACAGGAACAAAACCTACTC -3'
(R):5'- AGCACCCTGTTTGTGTGAAGAC -3'
Posted On2017-02-10