Incidental Mutation 'R5845:Stoml2'
ID453558
Institutional Source Beutler Lab
Gene Symbol Stoml2
Ensembl Gene ENSMUSG00000028455
Gene Namestomatin (Epb7.2)-like 2
Synonyms0610038F01Rik, SLP-2
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43027690-43031710 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 43030008 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000067481] [ENSMUST00000098109] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000135067] [ENSMUST00000136326] [ENSMUST00000138030]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036462
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067481
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098109
SMART Domains Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Phosphodiest 129 304 6.5e-18 PFAM
low complexity region 316 329 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 517 536 N/A INTRINSIC
low complexity region 547 567 N/A INTRINSIC
transmembrane domain 677 696 N/A INTRINSIC
transmembrane domain 711 730 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 866 888 N/A INTRINSIC
transmembrane domain 953 972 N/A INTRINSIC
low complexity region 987 1011 N/A INTRINSIC
transmembrane domain 1024 1046 N/A INTRINSIC
transmembrane domain 1061 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107956
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107957
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107958
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107959
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131506
Predicted Effect probably benign
Transcript: ENSMUST00000135067
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135660
SMART Domains Protein: ENSMUSP00000123478
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 2 153 4.16e-39 SMART
coiled coil region 189 210 N/A INTRINSIC
Pfam:Band_7_C 218 280 3.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136326
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143371
Predicted Effect probably benign
Transcript: ENSMUST00000149333
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180854
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele activated in T cells exhibit normal mitochondria migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Stoml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Stoml2 APN 4 43029366 unclassified probably benign
IGL02498:Stoml2 APN 4 43031045 missense probably benign 0.01
IGL03185:Stoml2 APN 4 43029065 missense probably benign 0.13
R0329:Stoml2 UTSW 4 43030238 critical splice donor site probably null
R0330:Stoml2 UTSW 4 43030238 critical splice donor site probably null
R1344:Stoml2 UTSW 4 43028197 missense probably benign 0.00
R2202:Stoml2 UTSW 4 43030243 nonsense probably null
R2203:Stoml2 UTSW 4 43030243 nonsense probably null
R2204:Stoml2 UTSW 4 43030243 nonsense probably null
R2205:Stoml2 UTSW 4 43030243 nonsense probably null
R4804:Stoml2 UTSW 4 43029882 missense probably benign 0.01
R4952:Stoml2 UTSW 4 43029589 missense probably benign 0.02
R5837:Stoml2 UTSW 4 43028989 missense probably damaging 1.00
R5882:Stoml2 UTSW 4 43031003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCGCAGGCATCGGATACC -3'
(R):5'- CAAGGTATCTGCCCTGGGTTTATC -3'

Sequencing Primer
(F):5'- ATCGGATACCCCAGCAGTCTG -3'
(R):5'- AAAATCCTGCATCTTCAGTTCTG -3'
Posted On2017-02-10