Incidental Mutation 'R5845:Prkab1'
ID453560
Institutional Source Beutler Lab
Gene Symbol Prkab1
Ensembl Gene ENSMUSG00000029513
Gene Nameprotein kinase, AMP-activated, beta 1 non-catalytic subunit
Synonyms
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5845 (G1)
Quality Score139
Status Validated
Chromosome5
Chromosomal Location116013586-116024508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116024160 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 30 (D30E)
Ref Sequence ENSEMBL: ENSMUSP00000138221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031486] [ENSMUST00000111999] [ENSMUST00000133098] [ENSMUST00000148208]
Predicted Effect probably benign
Transcript: ENSMUST00000031486
AA Change: D30E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031486
Gene: ENSMUSG00000029513
AA Change: D30E

DomainStartEndE-ValueType
Pfam:AMPK1_CBM 78 161 3e-37 PFAM
AMPKBI 180 270 4.04e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111999
AA Change: D30E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107630
Gene: ENSMUSG00000029513
AA Change: D30E

DomainStartEndE-ValueType
AMPKBI 180 270 4.04e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133098
AA Change: D30E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138749
Gene: ENSMUSG00000029513
AA Change: D30E

DomainStartEndE-ValueType
PDB:4CFF|D 1 139 4e-97 PDB
Blast:AMPKBI 90 139 2e-29 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147343
Predicted Effect probably benign
Transcript: ENSMUST00000148208
AA Change: D30E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138221
Gene: ENSMUSG00000029513
AA Change: D30E

DomainStartEndE-ValueType
PDB:4CFF|D 1 139 4e-97 PDB
Blast:AMPKBI 90 139 2e-29 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156331
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator of AMPK activity. The myristoylation and phosphorylation of this subunit have been shown to affect the enzyme activity and cellular localization of AMPK. This subunit may also serve as an adaptor molecule mediating the association of the AMPK complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele exhibit altered brain development, seizures, and postnatal death. Homozygotes for a null allele are protected from diet-induced obesity and hepatic insulin resistance. Homozygotes for another null allele show microcytic anemia and extramedullary hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Prkab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Prkab1 APN 5 116024110 missense probably damaging 1.00
IGL01730:Prkab1 APN 5 116021492 missense probably damaging 1.00
R0145:Prkab1 UTSW 5 116018085 splice site probably benign
R0233:Prkab1 UTSW 5 116021652 splice site probably benign
R2295:Prkab1 UTSW 5 116021656 splice site probably null
R6726:Prkab1 UTSW 5 116020033 missense probably benign 0.04
R7432:Prkab1 UTSW 5 116024162 missense possibly damaging 0.60
RF018:Prkab1 UTSW 5 116021630 missense probably damaging 0.96
X0062:Prkab1 UTSW 5 116021512 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTAATTAGGCACAAGTCCCAGAACG -3'
(R):5'- TCTGTTCGGAGTTCCAGTCG -3'

Sequencing Primer
(F):5'- GCTATGACAGAGCCACCTC -3'
(R):5'- TCGCCCGAGCCAGGTAAAG -3'
Posted On2017-02-10