Incidental Mutation 'R5845:Eif3c'
ID453569
Institutional Source Beutler Lab
Gene Symbol Eif3c
Ensembl Gene ENSMUSG00000030738
Gene Nameeukaryotic translation initiation factor 3, subunit C
SynonymsNIPIL(A3), 3230401O13Rik, 110kDa, Xs, Eif3s8, Xsl
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126546455-126566411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126564755 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 39 (S39G)
Ref Sequence ENSEMBL: ENSMUSP00000146083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032992] [ENSMUST00000180459] [ENSMUST00000205949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032992
AA Change: S39G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032992
Gene: ENSMUSG00000030738
AA Change: S39G

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:eIF-3c_N 29 703 9.6e-267 PFAM
PINT 776 864 9.7e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122504
Predicted Effect unknown
Transcript: ENSMUST00000180459
AA Change: S39G
SMART Domains Protein: ENSMUSP00000138023
Gene: ENSMUSG00000030738
AA Change: S39G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 113 126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205949
AA Change: S39G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.3665 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Mutations in this gene result in a range of abnormal limb development, including polydactyly, and white coat spotting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Eif3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Eif3c APN 7 126559008 missense probably benign
IGL01380:Eif3c APN 7 126564413 intron probably benign
IGL01434:Eif3c APN 7 126556410 missense probably damaging 0.99
IGL01534:Eif3c APN 7 126557695 missense probably benign 0.07
IGL02493:Eif3c APN 7 126558901 missense probably damaging 0.98
IGL02544:Eif3c APN 7 126547612 nonsense probably null
IGL02821:Eif3c APN 7 126558659 missense probably benign
IGL02963:Eif3c APN 7 126556820 missense probably benign 0.00
R0194:Eif3c UTSW 7 126558623 unclassified probably benign
R0421:Eif3c UTSW 7 126563712 missense possibly damaging 0.95
R1486:Eif3c UTSW 7 126564721 missense probably damaging 1.00
R2378:Eif3c UTSW 7 126552325 missense probably damaging 0.99
R4135:Eif3c UTSW 7 126566299 unclassified probably benign
R4223:Eif3c UTSW 7 126566299 unclassified probably benign
R4225:Eif3c UTSW 7 126566299 unclassified probably benign
R4898:Eif3c UTSW 7 126557454 missense probably benign 0.03
R5144:Eif3c UTSW 7 126563066 missense probably benign
R5246:Eif3c UTSW 7 126557238 missense possibly damaging 0.66
R6495:Eif3c UTSW 7 126547500 missense probably damaging 1.00
R6884:Eif3c UTSW 7 126556879 missense probably benign 0.01
R7236:Eif3c UTSW 7 126552323 missense possibly damaging 0.63
R7691:Eif3c UTSW 7 126551990 missense possibly damaging 0.95
R7744:Eif3c UTSW 7 126558894 missense probably damaging 1.00
X0065:Eif3c UTSW 7 126552085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACACTTGGTGACATCTCG -3'
(R):5'- TGTCAGGGTTTACAAGAGACCTC -3'

Sequencing Primer
(F):5'- CGAATCTTCATGGCATTACGG -3'
(R):5'- GAGACCTCATTTAGAGTTGCAGC -3'
Posted On2017-02-10