Incidental Mutation 'R5845:Dock5'
ID453583
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Namededicator of cytokinesis 5
Synonymslr2, 1110060D06Rik, rlc
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location67752135-67933442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67841101 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 225 (Y225N)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039135
AA Change: Y225N

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: Y225N

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224823
Meta Mutation Damage Score 0.1806 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 intron probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTGTCTCAAACCCAGTGAAGG -3'
(R):5'- TGGACTGAGGAATGATTGGTCC -3'

Sequencing Primer
(F):5'- CCCAGTGAAGGGCTCCTAGATAG -3'
(R):5'- ATCTGTTCAGTTCTCAGCAAGTG -3'
Posted On2017-02-10