Incidental Mutation 'R5845:Ccnf'
ID453590
Institutional Source Beutler Lab
Gene Symbol Ccnf
Ensembl Gene ENSMUSG00000072082
Gene Namecyclin F
SynonymsFbxo1, CycF
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24223232-24251409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24240793 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 229 (D229Y)
Ref Sequence ENSEMBL: ENSMUSP00000111048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115390
AA Change: D229Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: D229Y

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184733
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Ccnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Ccnf APN 17 24225012 missense probably damaging 1.00
IGL01942:Ccnf APN 17 24242320 missense probably benign 0.03
IGL02251:Ccnf APN 17 24226539 missense probably benign 0.00
IGL02945:Ccnf APN 17 24224916 missense probably damaging 0.99
IGL02952:Ccnf APN 17 24231325 missense possibly damaging 0.93
albuquerque UTSW 17 24223997 nonsense probably null
R0326:Ccnf UTSW 17 24231810 missense possibly damaging 0.84
R0891:Ccnf UTSW 17 24226777 missense possibly damaging 0.93
R1069:Ccnf UTSW 17 24223997 nonsense probably null
R1072:Ccnf UTSW 17 24237162 missense probably damaging 0.97
R1693:Ccnf UTSW 17 24226540 frame shift probably null
R2147:Ccnf UTSW 17 24230314 critical splice donor site probably null
R3929:Ccnf UTSW 17 24234382 missense probably damaging 1.00
R4081:Ccnf UTSW 17 24223898 makesense probably null
R4260:Ccnf UTSW 17 24226767 missense probably damaging 1.00
R4579:Ccnf UTSW 17 24231329 nonsense probably null
R4651:Ccnf UTSW 17 24231786 missense probably damaging 1.00
R4844:Ccnf UTSW 17 24230357 nonsense probably null
R4876:Ccnf UTSW 17 24230337 missense probably damaging 1.00
R5234:Ccnf UTSW 17 24234437 nonsense probably null
R5352:Ccnf UTSW 17 24243273 splice site probably null
R6084:Ccnf UTSW 17 24231837 missense probably damaging 1.00
R6219:Ccnf UTSW 17 24226704 nonsense probably null
R7021:Ccnf UTSW 17 24242231 missense probably damaging 1.00
R7176:Ccnf UTSW 17 24249402 missense possibly damaging 0.54
R7180:Ccnf UTSW 17 24223915 missense probably benign 0.00
R7485:Ccnf UTSW 17 24249258 missense probably damaging 0.97
R7763:Ccnf UTSW 17 24225012 missense probably damaging 1.00
R8016:Ccnf UTSW 17 24231810 missense possibly damaging 0.84
R8034:Ccnf UTSW 17 24231831 missense probably damaging 1.00
R8069:Ccnf UTSW 17 24225015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGAAACTGTGCCTGAGG -3'
(R):5'- TTTCTGCCGTGATCAGTCAGC -3'

Sequencing Primer
(F):5'- CATGAAACTGTGCCTGAGGTCTATC -3'
(R):5'- AGTCAGCACTGTGTACGACTG -3'
Posted On2017-02-10