Incidental Mutation 'R5845:Sult6b1'
ID453592
Institutional Source Beutler Lab
Gene Symbol Sult6b1
Ensembl Gene ENSMUSG00000038045
Gene Namesulfotransferase family, cytosolic, 6B, member 1
Synonyms
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location78883938-78906992 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78894630 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 148 (S148A)
Ref Sequence ENSEMBL: ENSMUSP00000132823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042683] [ENSMUST00000159710] [ENSMUST00000169544]
Predicted Effect probably damaging
Transcript: ENSMUST00000042683
AA Change: S110A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038282
Gene: ENSMUSG00000038045
AA Change: S110A

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 17 252 2.6e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146474
Predicted Effect probably benign
Transcript: ENSMUST00000159710
Predicted Effect probably damaging
Transcript: ENSMUST00000169544
AA Change: S148A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132823
Gene: ENSMUSG00000038045
AA Change: S148A

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 55 290 2.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180880
Meta Mutation Damage Score 0.8570 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Sult6b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Sult6b1 APN 17 78905576 missense probably benign 0.00
IGL02065:Sult6b1 APN 17 78889075 missense probably damaging 0.99
R0522:Sult6b1 UTSW 17 78905529 missense probably damaging 0.97
R1911:Sult6b1 UTSW 17 78888964 missense possibly damaging 0.81
R3546:Sult6b1 UTSW 17 78906907 missense probably benign 0.00
R4105:Sult6b1 UTSW 17 78906862 missense probably damaging 1.00
R4107:Sult6b1 UTSW 17 78906862 missense probably damaging 1.00
R4108:Sult6b1 UTSW 17 78906862 missense probably damaging 1.00
R5063:Sult6b1 UTSW 17 78905576 missense probably benign 0.00
R5478:Sult6b1 UTSW 17 78894672 splice site probably null
R6256:Sult6b1 UTSW 17 78906914 missense probably benign 0.05
R6374:Sult6b1 UTSW 17 78906931 missense probably benign 0.04
R7128:Sult6b1 UTSW 17 78894641 missense probably damaging 1.00
R7357:Sult6b1 UTSW 17 78894630 missense probably damaging 1.00
R7903:Sult6b1 UTSW 17 78890850 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGAAACCACTGCTGCAGCTG -3'
(R):5'- AGGTCCTCTCAGTACCACTC -3'

Sequencing Primer
(F):5'- GCTGCTGCAAAACCTCCTATAAATG -3'
(R):5'- AGGTCCTCTCAGTACCACTCTTCTG -3'
Posted On2017-02-10