Incidental Mutation 'R0554:Numa1'
ID45360
Institutional Source Beutler Lab
Gene Symbol Numa1
Ensembl Gene ENSMUSG00000066306
Gene Namenuclear mitotic apparatus protein 1
Synonyms6720401E04Rik
MMRRC Submission 038746-MU
Accession Numbers

Genbank: NM_133947.3; Ensembl: ENSMUST00000084852

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0554 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101934111-102014964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101995524 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 236 (S236P)
Ref Sequence ENSEMBL: ENSMUSP00000148215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000209639] [ENSMUST00000210475] [ENSMUST00000210679] [ENSMUST00000211272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084852
AA Change: S236P

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306
AA Change: S236P

DomainStartEndE-ValueType
low complexity region 187 201 N/A INTRINSIC
coiled coil region 211 249 N/A INTRINSIC
coiled coil region 274 818 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
internal_repeat_1 910 933 6.03e-6 PROSPERO
internal_repeat_2 911 951 2.35e-5 PROSPERO
low complexity region 979 992 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1063 1081 N/A INTRINSIC
internal_repeat_5 1094 1116 4.63e-5 PROSPERO
low complexity region 1130 1138 N/A INTRINSIC
low complexity region 1220 1233 N/A INTRINSIC
low complexity region 1271 1289 N/A INTRINSIC
low complexity region 1364 1374 N/A INTRINSIC
coiled coil region 1464 1681 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
internal_repeat_3 1718 1755 4.63e-5 PROSPERO
internal_repeat_4 1777 1819 4.63e-5 PROSPERO
internal_repeat_3 1800 1842 4.63e-5 PROSPERO
internal_repeat_4 1811 1854 4.63e-5 PROSPERO
low complexity region 1859 1875 N/A INTRINSIC
PDB:3RO2|B 1881 1908 3e-13 PDB
internal_repeat_2 1938 1977 2.35e-5 PROSPERO
internal_repeat_5 1973 1995 4.63e-5 PROSPERO
internal_repeat_1 2020 2043 6.03e-6 PROSPERO
low complexity region 2073 2085 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209639
AA Change: S236P

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210475
AA Change: S236P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000210679
AA Change: S209P
Predicted Effect probably benign
Transcript: ENSMUST00000211272
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out or hypomorphic allele exhibit embryonic lethality by E9.5. [provided by MGI curators]
Allele List at MGI

All alleles(97) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(94)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
1810024B03Rik A G 2: 127,187,276 M1T probably null Het
4930503L19Rik T C 18: 70,467,380 D386G probably damaging Het
Ace2 T A X: 164,175,951 N601K probably benign Het
Adam4 A C 12: 81,421,424 I141R probably damaging Het
Adcy10 G A 1: 165,513,130 G235S probably benign Het
Adcy5 G A 16: 35,294,017 V997I probably benign Het
Aff2 T G X: 69,864,074 W1221G possibly damaging Het
Ankrd44 T C 1: 54,763,758 N194D probably benign Het
Apba2 T G 7: 64,745,780 L668R probably damaging Het
Asph T C 4: 9,604,581 D152G probably damaging Het
Bcl3 C G 7: 19,820,066 V126L probably benign Het
Cd163 A G 6: 124,312,660 T446A probably benign Het
Cd209g C T 8: 4,134,995 probably benign Het
Cdadc1 A T 14: 59,586,452 V197E probably damaging Het
CN725425 T C 15: 91,260,763 C610R possibly damaging Het
Col6a2 A G 10: 76,611,161 probably null Het
Coro7 A G 16: 4,632,257 L576P possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Dhx57 A T 17: 80,260,236 L806* probably null Het
Dlec1 T C 9: 119,115,002 V373A probably benign Het
Dnah11 G T 12: 117,931,178 R3645S probably benign Het
Dnhd1 T C 7: 105,694,395 S1649P probably benign Het
Draxin T G 4: 148,107,963 K297N probably damaging Het
Epha7 T C 4: 28,951,401 S841P probably damaging Het
Esp8 T G 17: 40,530,275 D142E unknown Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Fancc T C 13: 63,317,469 S475G probably benign Het
Fmo3 T C 1: 162,954,332 N484S probably benign Het
Focad T C 4: 88,348,889 Y1046H unknown Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Fut8 A T 12: 77,364,970 I69L probably benign Het
Gm10436 T C 12: 88,177,558 T162A probably benign Het
Gm4951 G A 18: 60,245,417 R8H probably benign Het
Gnai3 A G 3: 108,123,612 I78T probably benign Het
Gpr182 T C 10: 127,751,071 I4V probably benign Het
Gpr63 T C 4: 25,007,447 M57T probably benign Het
Grm1 T A 10: 10,719,923 T654S probably benign Het
Gtf2h4 T C 17: 35,668,639 T371A probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hmcn1 T C 1: 150,719,117 N1867S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j A G 11: 3,499,644 Y713H probably damaging Het
Ints6 A T 14: 62,704,751 V511D possibly damaging Het
Itga4 A G 2: 79,279,117 Y220C probably damaging Het
Itgav T G 2: 83,794,270 S735A possibly damaging Het
Kctd16 A G 18: 40,258,439 I27V probably benign Het
Klhl6 T C 16: 19,953,593 E334G probably damaging Het
Lrmp G A 6: 145,165,287 A237T probably benign Het
Ltbp1 T A 17: 75,225,279 L116H probably damaging Het
Magohb T A 6: 131,285,697 H98L probably benign Het
Mgat2 A G 12: 69,185,392 T247A probably benign Het
Mtif2 G A 11: 29,533,398 probably null Het
Myrfl T C 10: 116,828,973 E384G probably damaging Het
Nfam1 G T 15: 83,033,209 R8S probably benign Het
Olfr1022 T C 2: 85,869,519 F309S probably benign Het
Olfr310 A T 7: 86,269,657 I44N probably damaging Het
Olfr317 T C 11: 58,733,039 N42S probably damaging Het
Olfr777 T C 10: 129,268,499 T275A probably benign Het
Orc4 C T 2: 48,905,421 S431N probably benign Het
Pax2 T C 19: 44,761,861 V129A probably damaging Het
Pcdhb15 A G 18: 37,474,519 D268G probably damaging Het
Pdcd1 G A 1: 94,039,382 R264C probably damaging Het
Pi15 T A 1: 17,621,648 M187K probably benign Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plagl1 A G 10: 13,127,182 T65A probably benign Het
Prss48 T A 3: 86,000,921 Q18L probably benign Het
Prune2 T A 19: 17,125,218 C2580* probably null Het
Rab40b T A 11: 121,359,606 Q74L probably damaging Het
Raf1 A G 6: 115,623,530 I376T probably benign Het
Rbm46 A T 3: 82,865,268 F186I probably damaging Het
Reps1 C T 10: 18,123,119 T720M possibly damaging Het
Rgs22 A G 15: 36,054,709 M649T probably benign Het
Rhot1 C T 11: 80,243,438 R47* probably null Het
Rhox2f A G X: 37,571,471 Y8C possibly damaging Het
Rnf17 A G 14: 56,522,550 Y1604C probably damaging Het
Rnf40 T C 7: 127,602,584 C943R probably damaging Het
Ropn1l A T 15: 31,451,149 M63K probably benign Het
Sbf2 C A 7: 110,428,287 V501F probably damaging Het
Sh3bp1 T A 15: 78,907,267 M354K probably damaging Het
Sipa1l3 T C 7: 29,388,030 H590R possibly damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Sulf1 T C 1: 12,805,194 Y143H probably damaging Het
Tiam2 A T 17: 3,438,681 R755* probably null Het
Trim12c C A 7: 104,344,962 L228F probably damaging Het
Ttc23l G T 15: 10,530,657 Q290K probably benign Het
Uba3 T C 6: 97,191,260 probably null Het
Ugt1a10 A G 1: 88,056,095 E205G probably damaging Het
Ugt3a2 T A 15: 9,351,120 S72T probably benign Het
Upk3bl C T 5: 136,059,794 T113I probably damaging Het
Uspl1 T A 5: 149,187,834 D20E probably damaging Het
Vmn2r19 G A 6: 123,336,143 G724E probably damaging Het
Vmn2r63 T A 7: 42,933,705 K29* probably null Het
Vwf C T 6: 125,642,781 A1474V probably benign Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Zfp536 T C 7: 37,480,819 D787G probably damaging Het
Zfp692 A G 11: 58,314,227 H434R probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Numa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Numa1 APN 7 102013286 missense possibly damaging 0.95
IGL00819:Numa1 APN 7 101992710 missense possibly damaging 0.90
IGL01103:Numa1 APN 7 102001571 missense probably benign 0.01
IGL01153:Numa1 APN 7 101994744 missense probably damaging 1.00
IGL01954:Numa1 APN 7 101996093 nonsense probably null
IGL02114:Numa1 APN 7 102011876 unclassified probably benign
IGL02245:Numa1 APN 7 102000394 missense probably benign 0.02
IGL02259:Numa1 APN 7 101987748 missense possibly damaging 0.93
IGL02313:Numa1 APN 7 102000232 nonsense probably null
IGL02316:Numa1 APN 7 102001370 missense probably damaging 1.00
IGL02386:Numa1 APN 7 102007532 missense probably benign 0.00
IGL02517:Numa1 APN 7 102012009 missense probably benign 0.01
IGL02529:Numa1 APN 7 101999953 splice site probably null
IGL02664:Numa1 APN 7 101998902 missense possibly damaging 0.83
IGL02721:Numa1 APN 7 101999911 missense probably benign 0.01
IGL02816:Numa1 APN 7 101996100 missense probably damaging 1.00
IGL03126:Numa1 APN 7 102000667 nonsense probably null
meltdown UTSW 7 101990571 critical splice acceptor site probably null
1mM(1):Numa1 UTSW 7 101994715 missense probably benign 0.06
PIT4651001:Numa1 UTSW 7 102013934 missense probably damaging 0.97
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0548:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0592:Numa1 UTSW 7 102013897 missense probably benign
R0669:Numa1 UTSW 7 101999677 missense probably benign
R0856:Numa1 UTSW 7 101998948 missense probably damaging 1.00
R1072:Numa1 UTSW 7 102001150 splice site probably null
R1776:Numa1 UTSW 7 102011050 missense probably damaging 1.00
R1898:Numa1 UTSW 7 101992720 critical splice donor site probably null
R1969:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1970:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1971:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R2180:Numa1 UTSW 7 101999990 missense probably benign 0.00
R2256:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2257:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2508:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R2958:Numa1 UTSW 7 102009495 missense possibly damaging 0.92
R4210:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4211:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4643:Numa1 UTSW 7 102000665 splice site probably null
R4783:Numa1 UTSW 7 102013566 missense probably damaging 1.00
R4823:Numa1 UTSW 7 101996037 missense probably damaging 1.00
R4908:Numa1 UTSW 7 102012805 missense probably damaging 1.00
R4934:Numa1 UTSW 7 102010857 missense probably benign 0.32
R4981:Numa1 UTSW 7 101992674 missense probably damaging 1.00
R5120:Numa1 UTSW 7 101977437 missense probably damaging 0.99
R5122:Numa1 UTSW 7 102013769 missense probably damaging 1.00
R5210:Numa1 UTSW 7 101999981 missense probably benign 0.03
R5230:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R5547:Numa1 UTSW 7 102013930 missense probably damaging 1.00
R5861:Numa1 UTSW 7 102009287 splice site probably null
R6006:Numa1 UTSW 7 101992719 critical splice donor site probably null
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6295:Numa1 UTSW 7 102000767 missense probably benign 0.03
R6322:Numa1 UTSW 7 102000920 missense probably damaging 1.00
R6413:Numa1 UTSW 7 101990571 critical splice acceptor site probably null
R6786:Numa1 UTSW 7 101992638 missense probably benign 0.05
R7218:Numa1 UTSW 7 102000910 missense probably benign 0.02
R7312:Numa1 UTSW 7 101990599 missense possibly damaging 0.92
R7374:Numa1 UTSW 7 102009128 missense probably benign 0.00
R7626:Numa1 UTSW 7 101999423 missense probably benign 0.42
R7769:Numa1 UTSW 7 101999000 missense possibly damaging 0.77
R7830:Numa1 UTSW 7 101999285 missense probably benign 0.03
R7886:Numa1 UTSW 7 102013865 missense probably benign 0.27
R7935:Numa1 UTSW 7 102002331 missense probably damaging 0.96
R8134:Numa1 UTSW 7 102001627 missense probably benign 0.14
R8143:Numa1 UTSW 7 101999684 missense possibly damaging 0.82
R8217:Numa1 UTSW 7 101992669 missense possibly damaging 0.66
R8263:Numa1 UTSW 7 101999284 missense probably benign 0.03
RF013:Numa1 UTSW 7 101999780 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998331 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998402 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGTAGCCTGGCAGATAAAGAACCC -3'
(R):5'- GCACAGTATCCGTGCCACAGAAAAG -3'

Sequencing Primer
(F):5'- TCCCTAACCAAACACTGGTTATGG -3'
(R):5'- TGAACCCAGTGTCTACCAGG -3'
Posted On2013-06-11