Incidental Mutation 'R5846:Klhl35'
ID453620
Institutional Source Beutler Lab
Gene Symbol Klhl35
Ensembl Gene ENSMUSG00000035298
Gene Namekelch-like 35
Synonyms
MMRRC Submission 044064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5846 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99466004-99474022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99472887 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 65 (G65D)
Ref Sequence ENSEMBL: ENSMUSP00000120346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037359] [ENSMUST00000152424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037359
AA Change: G498D

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041363
Gene: ENSMUSG00000035298
AA Change: G498D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
BTB 40 141 5.82e-17 SMART
BACK 146 248 1.21e-27 SMART
Kelch 292 341 6.32e-2 SMART
Kelch 342 385 1.18e-5 SMART
Kelch 386 432 3.01e-12 SMART
Kelch 433 480 2.23e-1 SMART
Kelch 481 522 2.71e-5 SMART
Kelch 523 570 1.39e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142339
Predicted Effect probably damaging
Transcript: ENSMUST00000152424
AA Change: G65D

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120346
Gene: ENSMUSG00000035298
AA Change: G65D

DomainStartEndE-ValueType
Pfam:Kelch_1 1 34 1.1e-8 PFAM
Pfam:Kelch_6 36 79 3.6e-8 PFAM
Pfam:Kelch_1 38 76 2.6e-7 PFAM
low complexity region 106 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153736
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,033 S335P unknown Het
Ace3 A T 11: 105,998,362 I473F probably benign Het
Adcy2 T A 13: 68,738,588 N281Y probably damaging Het
Adgra1 T A 7: 139,875,280 W275R probably damaging Het
Apmap T C 2: 150,608,421 D20G probably damaging Het
Arap2 T C 5: 62,649,773 T1184A probably damaging Het
Atp13a2 T C 4: 140,995,596 V303A possibly damaging Het
BC004004 A T 17: 29,282,308 probably benign Het
C1s1 G A 6: 124,540,953 P23S possibly damaging Het
C1s2 T A 6: 124,631,164 N197Y probably damaging Het
Camsap3 A G 8: 3,603,980 H539R probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Cct4 T C 11: 23,001,354 probably benign Het
Chrm2 A T 6: 36,523,450 T81S probably damaging Het
Dnaaf3 A T 7: 4,523,687 S464T possibly damaging Het
Dnah10 T A 5: 124,823,373 I3898N possibly damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dnajc13 T C 9: 104,190,385 K1187E probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Dst C T 1: 34,195,861 Q3674* probably null Het
Eef1a2 T C 2: 181,152,983 Y141C probably damaging Het
Fads3 G T 19: 10,053,033 Q178H probably null Het
Fbxw22 T A 9: 109,386,761 M140L probably benign Het
Fndc7 A G 3: 108,881,391 I178T probably damaging Het
Foxd1 T C 13: 98,355,041 M141T probably damaging Het
Havcr2 T C 11: 46,469,516 I141T probably benign Het
Hectd1 A C 12: 51,773,835 N1190K probably damaging Het
Hist1h4b T C 13: 23,757,232 V71A possibly damaging Het
Hook3 T A 8: 26,044,327 probably benign Het
Hpgd T A 8: 56,307,667 I133N possibly damaging Het
Itih2 T C 2: 10,097,903 R807G probably benign Het
Lrch4 C G 5: 137,633,657 C48W probably damaging Het
Mafa A G 15: 75,747,778 S49P probably benign Het
Magi1 A G 6: 93,685,603 V1170A probably damaging Het
Mprip A T 11: 59,758,554 K1028M probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Numb G T 12: 83,876,747 probably benign Het
Obscn A G 11: 59,038,609 L6063P probably damaging Het
Olfr1371 A G 11: 52,213,054 *312Q probably null Het
Olfr804 A T 10: 129,704,887 N3I probably damaging Het
P3h3 A T 6: 124,857,194 probably null Het
Pi4k2a A G 19: 42,115,038 D329G probably benign Het
Ptch1 T C 13: 63,565,454 probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Sdk1 T C 5: 142,114,393 Y1393H probably damaging Het
Slc18a3 T A 14: 32,463,923 M168L probably benign Het
Smurf1 T C 5: 144,879,380 T722A probably damaging Het
Ssr2 C T 3: 88,581,072 P85L probably damaging Het
Syne2 G T 12: 76,028,124 A4614S probably benign Het
Tgfbr3 C A 5: 107,140,655 G380V possibly damaging Het
Tk1 G T 11: 117,815,922 probably benign Het
Tmem245 A T 4: 56,903,241 S610T probably benign Het
Tmtc2 A G 10: 105,271,441 probably benign Het
Trim30b A G 7: 104,357,371 Y93H possibly damaging Het
Tsks A G 7: 44,943,988 D126G probably damaging Het
Ttn T A 2: 76,903,468 probably benign Het
Usp15 A G 10: 123,181,742 W50R probably damaging Het
Vmn2r55 A T 7: 12,670,565 F304I probably benign Het
Xirp2 T A 2: 67,509,243 D609E probably damaging Het
Zan C T 5: 137,394,376 probably null Het
Other mutations in Klhl35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Klhl35 APN 7 99471681 splice site probably benign
IGL03003:Klhl35 APN 7 99470343 missense probably damaging 0.98
R0268:Klhl35 UTSW 7 99471751 missense probably benign 0.33
R1563:Klhl35 UTSW 7 99471695 missense probably damaging 1.00
R1770:Klhl35 UTSW 7 99473875 missense possibly damaging 0.57
R1901:Klhl35 UTSW 7 99470220 missense probably damaging 1.00
R2392:Klhl35 UTSW 7 99473824 missense possibly damaging 0.72
R3810:Klhl35 UTSW 7 99470241 missense probably benign 0.07
R4194:Klhl35 UTSW 7 99473851 unclassified probably null
R4349:Klhl35 UTSW 7 99473719 missense probably benign 0.18
R4960:Klhl35 UTSW 7 99469068 missense probably damaging 1.00
R6161:Klhl35 UTSW 7 99473337 unclassified probably benign
R6494:Klhl35 UTSW 7 99472899 missense probably damaging 1.00
R7060:Klhl35 UTSW 7 99468458 missense possibly damaging 0.81
R7758:Klhl35 UTSW 7 99473218 missense unknown
R7762:Klhl35 UTSW 7 99468440 missense probably benign 0.11
X0023:Klhl35 UTSW 7 99470341 nonsense probably null
X0064:Klhl35 UTSW 7 99471841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGAGCAGTTCAGGGTG -3'
(R):5'- AAATGAGAGGTGATTTGTCACTGGG -3'

Sequencing Primer
(F):5'- CAGGGTGAGGCTCTTTTACCAC -3'
(R):5'- TTTGTCACTGGGAGGACAAGC -3'
Posted On2017-02-10