Incidental Mutation 'R5846:Camsap3'
ID453624
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Namecalmodulin regulated spectrin-associated protein family, member 3
SynonymsNezha, 2310057J16Rik
MMRRC Submission 044064-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R5846 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3587293-3609075 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3603980 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 539 (H539R)
Ref Sequence ENSEMBL: ENSMUSP00000146852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208240]
Predicted Effect probably damaging
Transcript: ENSMUST00000057028
AA Change: H523R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: H523R

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect probably damaging
Transcript: ENSMUST00000171962
AA Change: H524R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: H524R

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207077
AA Change: H539R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000207152
Predicted Effect probably benign
Transcript: ENSMUST00000207432
AA Change: H550R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000207533
Predicted Effect probably benign
Transcript: ENSMUST00000207712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably damaging
Transcript: ENSMUST00000207970
AA Change: H534R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect probably benign
Transcript: ENSMUST00000208240
Meta Mutation Damage Score 0.1369 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 97% (67/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,033 S335P unknown Het
Ace3 A T 11: 105,998,362 I473F probably benign Het
Adcy2 T A 13: 68,738,588 N281Y probably damaging Het
Adgra1 T A 7: 139,875,280 W275R probably damaging Het
Apmap T C 2: 150,608,421 D20G probably damaging Het
Arap2 T C 5: 62,649,773 T1184A probably damaging Het
Atp13a2 T C 4: 140,995,596 V303A possibly damaging Het
BC004004 A T 17: 29,282,308 probably benign Het
C1s1 G A 6: 124,540,953 P23S possibly damaging Het
C1s2 T A 6: 124,631,164 N197Y probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Cct4 T C 11: 23,001,354 probably benign Het
Chrm2 A T 6: 36,523,450 T81S probably damaging Het
Dnaaf3 A T 7: 4,523,687 S464T possibly damaging Het
Dnah10 T A 5: 124,823,373 I3898N possibly damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dnajc13 T C 9: 104,190,385 K1187E probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Dst C T 1: 34,195,861 Q3674* probably null Het
Eef1a2 T C 2: 181,152,983 Y141C probably damaging Het
Fads3 G T 19: 10,053,033 Q178H probably null Het
Fbxw22 T A 9: 109,386,761 M140L probably benign Het
Fndc7 A G 3: 108,881,391 I178T probably damaging Het
Foxd1 T C 13: 98,355,041 M141T probably damaging Het
Havcr2 T C 11: 46,469,516 I141T probably benign Het
Hectd1 A C 12: 51,773,835 N1190K probably damaging Het
Hist1h4b T C 13: 23,757,232 V71A possibly damaging Het
Hook3 T A 8: 26,044,327 probably benign Het
Hpgd T A 8: 56,307,667 I133N possibly damaging Het
Itih2 T C 2: 10,097,903 R807G probably benign Het
Klhl35 G A 7: 99,472,887 G65D probably damaging Het
Lrch4 C G 5: 137,633,657 C48W probably damaging Het
Mafa A G 15: 75,747,778 S49P probably benign Het
Magi1 A G 6: 93,685,603 V1170A probably damaging Het
Mprip A T 11: 59,758,554 K1028M probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Numb G T 12: 83,876,747 probably benign Het
Obscn A G 11: 59,038,609 L6063P probably damaging Het
Olfr1371 A G 11: 52,213,054 *312Q probably null Het
Olfr804 A T 10: 129,704,887 N3I probably damaging Het
P3h3 A T 6: 124,857,194 probably null Het
Pi4k2a A G 19: 42,115,038 D329G probably benign Het
Ptch1 T C 13: 63,565,454 probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Sdk1 T C 5: 142,114,393 Y1393H probably damaging Het
Slc18a3 T A 14: 32,463,923 M168L probably benign Het
Smurf1 T C 5: 144,879,380 T722A probably damaging Het
Ssr2 C T 3: 88,581,072 P85L probably damaging Het
Syne2 G T 12: 76,028,124 A4614S probably benign Het
Tgfbr3 C A 5: 107,140,655 G380V possibly damaging Het
Tk1 G T 11: 117,815,922 probably benign Het
Tmem245 A T 4: 56,903,241 S610T probably benign Het
Tmtc2 A G 10: 105,271,441 probably benign Het
Trim30b A G 7: 104,357,371 Y93H possibly damaging Het
Tsks A G 7: 44,943,988 D126G probably damaging Het
Ttn T A 2: 76,903,468 probably benign Het
Usp15 A G 10: 123,181,742 W50R probably damaging Het
Vmn2r55 A T 7: 12,670,565 F304I probably benign Het
Xirp2 T A 2: 67,509,243 D609E probably damaging Het
Zan C T 5: 137,394,376 probably null Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3602077 missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3602115 splice site probably benign
IGL01457:Camsap3 APN 8 3604795 missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3608508 missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3603845 missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3603913 missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3604288 missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0347:Camsap3 UTSW 8 3602029 missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R0946:Camsap3 UTSW 8 3604442 missense probably benign 0.00
R1169:Camsap3 UTSW 8 3603866 missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3603968 missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R1820:Camsap3 UTSW 8 3603485 missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3603922 nonsense probably null
R1914:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3604789 missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3606808 missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3606515 missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3600689 missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3604244 missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3600680 missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3603812 missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3604276 missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3597899 missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3601999 missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3601971 missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3603941 missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3604186 missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3608742 missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3608242 missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3607834 unclassified probably benign
R7109:Camsap3 UTSW 8 3598087 missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3600371 missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3604116 missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3604648 missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R7512:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R7779:Camsap3 UTSW 8 3597887 missense probably damaging 1.00
R8134:Camsap3 UTSW 8 3598075 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATTCACAGTGCTGAGCCC -3'
(R):5'- ATCTCTGAGCTCAAGGCCTC -3'

Sequencing Primer
(F):5'- CCCGACTGCTCCCTGATG -3'
(R):5'- TCAAGGCCTCAGGTGCTAC -3'
Posted On2017-02-10