Incidental Mutation 'R5846:Hook3'
ID453626
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Namehook microtubule tethering protein 3
SynonymsE330005F07Rik, 5830454D03Rik
MMRRC Submission 044064-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5846 (G1)
Quality Score201
Status Validated
Chromosome8
Chromosomal Location26021421-26119224 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 26044327 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
Predicted Effect probably benign
Transcript: ENSMUST00000037182
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211777
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,033 S335P unknown Het
Ace3 A T 11: 105,998,362 I473F probably benign Het
Adcy2 T A 13: 68,738,588 N281Y probably damaging Het
Adgra1 T A 7: 139,875,280 W275R probably damaging Het
Apmap T C 2: 150,608,421 D20G probably damaging Het
Arap2 T C 5: 62,649,773 T1184A probably damaging Het
Atp13a2 T C 4: 140,995,596 V303A possibly damaging Het
BC004004 A T 17: 29,282,308 probably benign Het
C1s1 G A 6: 124,540,953 P23S possibly damaging Het
C1s2 T A 6: 124,631,164 N197Y probably damaging Het
Camsap3 A G 8: 3,603,980 H539R probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Cct4 T C 11: 23,001,354 probably benign Het
Chrm2 A T 6: 36,523,450 T81S probably damaging Het
Dnaaf3 A T 7: 4,523,687 S464T possibly damaging Het
Dnah10 T A 5: 124,823,373 I3898N possibly damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dnajc13 T C 9: 104,190,385 K1187E probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Dst C T 1: 34,195,861 Q3674* probably null Het
Eef1a2 T C 2: 181,152,983 Y141C probably damaging Het
Fads3 G T 19: 10,053,033 Q178H probably null Het
Fbxw22 T A 9: 109,386,761 M140L probably benign Het
Fndc7 A G 3: 108,881,391 I178T probably damaging Het
Foxd1 T C 13: 98,355,041 M141T probably damaging Het
Havcr2 T C 11: 46,469,516 I141T probably benign Het
Hectd1 A C 12: 51,773,835 N1190K probably damaging Het
Hist1h4b T C 13: 23,757,232 V71A possibly damaging Het
Hpgd T A 8: 56,307,667 I133N possibly damaging Het
Itih2 T C 2: 10,097,903 R807G probably benign Het
Klhl35 G A 7: 99,472,887 G65D probably damaging Het
Lrch4 C G 5: 137,633,657 C48W probably damaging Het
Mafa A G 15: 75,747,778 S49P probably benign Het
Magi1 A G 6: 93,685,603 V1170A probably damaging Het
Mprip A T 11: 59,758,554 K1028M probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Numb G T 12: 83,876,747 probably benign Het
Obscn A G 11: 59,038,609 L6063P probably damaging Het
Olfr1371 A G 11: 52,213,054 *312Q probably null Het
Olfr804 A T 10: 129,704,887 N3I probably damaging Het
P3h3 A T 6: 124,857,194 probably null Het
Pi4k2a A G 19: 42,115,038 D329G probably benign Het
Ptch1 T C 13: 63,565,454 probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Sdk1 T C 5: 142,114,393 Y1393H probably damaging Het
Slc18a3 T A 14: 32,463,923 M168L probably benign Het
Smurf1 T C 5: 144,879,380 T722A probably damaging Het
Ssr2 C T 3: 88,581,072 P85L probably damaging Het
Syne2 G T 12: 76,028,124 A4614S probably benign Het
Tgfbr3 C A 5: 107,140,655 G380V possibly damaging Het
Tk1 G T 11: 117,815,922 probably benign Het
Tmem245 A T 4: 56,903,241 S610T probably benign Het
Tmtc2 A G 10: 105,271,441 probably benign Het
Trim30b A G 7: 104,357,371 Y93H possibly damaging Het
Tsks A G 7: 44,943,988 D126G probably damaging Het
Ttn T A 2: 76,903,468 probably benign Het
Usp15 A G 10: 123,181,742 W50R probably damaging Het
Vmn2r55 A T 7: 12,670,565 F304I probably benign Het
Xirp2 T A 2: 67,509,243 D609E probably damaging Het
Zan C T 5: 137,394,376 probably null Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26059250 missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26048298 missense probably damaging 1.00
IGL01145:Hook3 APN 8 26059344 missense probably benign 0.00
IGL01514:Hook3 APN 8 26088189 missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26070159 missense probably benign 0.00
IGL01832:Hook3 APN 8 26072365 missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26039732 missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26088055 splice site probably benign
IGL01948:Hook3 APN 8 26059312 missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26070265 missense probably damaging 0.99
IGL02675:Hook3 APN 8 26061434 missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26095754 splice site probably benign
Rufio UTSW 8 26034940 nonsense probably null
R0384:Hook3 UTSW 8 26044235 splice site probably null
R0600:Hook3 UTSW 8 26118986 missense probably benign
R1037:Hook3 UTSW 8 26072350 missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26038106 missense probably damaging 0.98
R1563:Hook3 UTSW 8 26110752 missense probably benign 0.06
R1767:Hook3 UTSW 8 26071056 critical splice donor site probably null
R1806:Hook3 UTSW 8 26068659 missense probably damaging 1.00
R2025:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2026:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2027:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2091:Hook3 UTSW 8 26059394 splice site probably benign
R2153:Hook3 UTSW 8 26070197 missense probably damaging 1.00
R2184:Hook3 UTSW 8 26118983 missense probably benign 0.00
R4586:Hook3 UTSW 8 26032011 missense probably damaging 0.98
R4863:Hook3 UTSW 8 26038029 missense probably damaging 1.00
R4971:Hook3 UTSW 8 26082579 missense probably benign 0.22
R5023:Hook3 UTSW 8 26032019 frame shift probably null
R5026:Hook3 UTSW 8 26110757 missense probably damaging 0.98
R5068:Hook3 UTSW 8 26095757 critical splice donor site probably null
R5253:Hook3 UTSW 8 26072291 missense probably benign
R5383:Hook3 UTSW 8 26118989 missense probably benign 0.01
R5437:Hook3 UTSW 8 26061422 missense probably benign 0.05
R5528:Hook3 UTSW 8 26072293 missense probably damaging 1.00
R5551:Hook3 UTSW 8 26068611 missense possibly damaging 0.75
R5907:Hook3 UTSW 8 26044278 intron probably benign
R6082:Hook3 UTSW 8 26110785 missense probably benign 0.00
R6124:Hook3 UTSW 8 26059272 missense probably benign 0.20
R6301:Hook3 UTSW 8 26034940 nonsense probably null
R6314:Hook3 UTSW 8 26088108 missense probably benign
R6448:Hook3 UTSW 8 26093664 missense probably benign 0.02
R6810:Hook3 UTSW 8 26032422 splice site probably null
R7168:Hook3 UTSW 8 26071086 missense probably benign 0.02
R7856:Hook3 UTSW 8 26035221 missense probably damaging 1.00
R7988:Hook3 UTSW 8 26073647 missense probably benign 0.02
R8079:Hook3 UTSW 8 26088058 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCAAGGACCACTTATGCCC -3'
(R):5'- CTGAATCCAGGAATATTTGGGTCTC -3'

Sequencing Primer
(F):5'- AGGACCACTTATGCCCTAGTC -3'
(R):5'- CTGCTCTTTTATCGAAGAGG -3'
Posted On2017-02-10