Incidental Mutation 'R5846:Fbxw22'
ID453630
Institutional Source Beutler Lab
Gene Symbol Fbxw22
Ensembl Gene ENSMUSG00000070324
Gene NameF-box and WD-40 domain protein 22
SynonymsGm5164
MMRRC Submission 044064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5846 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109378400-109404296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109386761 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 140 (M140L)
Ref Sequence ENSEMBL: ENSMUSP00000079460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080626] [ENSMUST00000197213]
Predicted Effect probably benign
Transcript: ENSMUST00000080626
AA Change: M140L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079460
Gene: ENSMUSG00000070324
AA Change: M140L

DomainStartEndE-ValueType
FBOX 5 45 1.02e-5 SMART
SCOP:d1gxra_ 128 220 1e-5 SMART
Blast:WD40 137 176 6e-9 BLAST
Predicted Effect silent
Transcript: ENSMUST00000197213
Meta Mutation Damage Score 0.1019 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,033 S335P unknown Het
Ace3 A T 11: 105,998,362 I473F probably benign Het
Adcy2 T A 13: 68,738,588 N281Y probably damaging Het
Adgra1 T A 7: 139,875,280 W275R probably damaging Het
Apmap T C 2: 150,608,421 D20G probably damaging Het
Arap2 T C 5: 62,649,773 T1184A probably damaging Het
Atp13a2 T C 4: 140,995,596 V303A possibly damaging Het
BC004004 A T 17: 29,282,308 probably benign Het
C1s1 G A 6: 124,540,953 P23S possibly damaging Het
C1s2 T A 6: 124,631,164 N197Y probably damaging Het
Camsap3 A G 8: 3,603,980 H539R probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Cct4 T C 11: 23,001,354 probably benign Het
Chrm2 A T 6: 36,523,450 T81S probably damaging Het
Dnaaf3 A T 7: 4,523,687 S464T possibly damaging Het
Dnah10 T A 5: 124,823,373 I3898N possibly damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dnajc13 T C 9: 104,190,385 K1187E probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Dst C T 1: 34,195,861 Q3674* probably null Het
Eef1a2 T C 2: 181,152,983 Y141C probably damaging Het
Fads3 G T 19: 10,053,033 Q178H probably null Het
Fndc7 A G 3: 108,881,391 I178T probably damaging Het
Foxd1 T C 13: 98,355,041 M141T probably damaging Het
Havcr2 T C 11: 46,469,516 I141T probably benign Het
Hectd1 A C 12: 51,773,835 N1190K probably damaging Het
Hist1h4b T C 13: 23,757,232 V71A possibly damaging Het
Hook3 T A 8: 26,044,327 probably benign Het
Hpgd T A 8: 56,307,667 I133N possibly damaging Het
Itih2 T C 2: 10,097,903 R807G probably benign Het
Klhl35 G A 7: 99,472,887 G65D probably damaging Het
Lrch4 C G 5: 137,633,657 C48W probably damaging Het
Mafa A G 15: 75,747,778 S49P probably benign Het
Magi1 A G 6: 93,685,603 V1170A probably damaging Het
Mprip A T 11: 59,758,554 K1028M probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Numb G T 12: 83,876,747 probably benign Het
Obscn A G 11: 59,038,609 L6063P probably damaging Het
Olfr1371 A G 11: 52,213,054 *312Q probably null Het
Olfr804 A T 10: 129,704,887 N3I probably damaging Het
P3h3 A T 6: 124,857,194 probably null Het
Pi4k2a A G 19: 42,115,038 D329G probably benign Het
Ptch1 T C 13: 63,565,454 probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Sdk1 T C 5: 142,114,393 Y1393H probably damaging Het
Slc18a3 T A 14: 32,463,923 M168L probably benign Het
Smurf1 T C 5: 144,879,380 T722A probably damaging Het
Ssr2 C T 3: 88,581,072 P85L probably damaging Het
Syne2 G T 12: 76,028,124 A4614S probably benign Het
Tgfbr3 C A 5: 107,140,655 G380V possibly damaging Het
Tk1 G T 11: 117,815,922 probably benign Het
Tmem245 A T 4: 56,903,241 S610T probably benign Het
Tmtc2 A G 10: 105,271,441 probably benign Het
Trim30b A G 7: 104,357,371 Y93H possibly damaging Het
Tsks A G 7: 44,943,988 D126G probably damaging Het
Ttn T A 2: 76,903,468 probably benign Het
Usp15 A G 10: 123,181,742 W50R probably damaging Het
Vmn2r55 A T 7: 12,670,565 F304I probably benign Het
Xirp2 T A 2: 67,509,243 D609E probably damaging Het
Zan C T 5: 137,394,376 probably null Het
Other mutations in Fbxw22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Fbxw22 APN 9 109384040 missense possibly damaging 0.68
IGL00655:Fbxw22 APN 9 109382244 splice site probably benign
IGL01122:Fbxw22 APN 9 109386671 missense probably damaging 0.99
IGL01419:Fbxw22 APN 9 109381722 missense probably benign 0.03
IGL01455:Fbxw22 APN 9 109384994 missense probably benign
IGL01486:Fbxw22 APN 9 109378873 missense probably damaging 1.00
IGL01734:Fbxw22 APN 9 109383925 missense probably damaging 0.98
IGL02106:Fbxw22 APN 9 109402019 missense possibly damaging 0.86
IGL02255:Fbxw22 APN 9 109386551 splice site probably benign
IGL02466:Fbxw22 APN 9 109385092 missense probably damaging 1.00
IGL02820:Fbxw22 APN 9 109386664 missense probably damaging 1.00
R0395:Fbxw22 UTSW 9 109381685 missense probably damaging 1.00
R0705:Fbxw22 UTSW 9 109403096 missense possibly damaging 0.92
R0741:Fbxw22 UTSW 9 109382219 missense probably benign 0.01
R1603:Fbxw22 UTSW 9 109378847 missense probably benign 0.00
R1673:Fbxw22 UTSW 9 109382128 missense possibly damaging 0.93
R1874:Fbxw22 UTSW 9 109385111 nonsense probably null
R2265:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2269:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2385:Fbxw22 UTSW 9 109382142 missense probably damaging 1.00
R4329:Fbxw22 UTSW 9 109384043 missense probably damaging 1.00
R4695:Fbxw22 UTSW 9 109378871 missense probably damaging 1.00
R4731:Fbxw22 UTSW 9 109378869 missense probably benign 0.02
R4915:Fbxw22 UTSW 9 109383941 missense probably damaging 1.00
R5010:Fbxw22 UTSW 9 109403424 missense probably benign 0.40
R5070:Fbxw22 UTSW 9 109385115 missense probably benign
R5319:Fbxw22 UTSW 9 109383947 missense possibly damaging 0.52
R5571:Fbxw22 UTSW 9 109403088 missense probably damaging 1.00
R5765:Fbxw22 UTSW 9 109384996 missense probably benign 0.00
R6002:Fbxw22 UTSW 9 109381682 nonsense probably null
R6180:Fbxw22 UTSW 9 109386679 missense probably damaging 1.00
R6313:Fbxw22 UTSW 9 109403397 missense probably damaging 0.99
R6860:Fbxw22 UTSW 9 109383962 missense probably benign 0.01
R6949:Fbxw22 UTSW 9 109382076 missense probably benign 0.06
R7084:Fbxw22 UTSW 9 109404223 missense probably damaging 1.00
R7296:Fbxw22 UTSW 9 109382075 missense probably benign
R8499:Fbxw22 UTSW 9 109385000 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGCTTGCAGTAATTGACAGG -3'
(R):5'- TGCTCCCCTCTGAACATAATG -3'

Sequencing Primer
(F):5'- GAAAAGGACAGGGCTTTAGTTGC -3'
(R):5'- TACAGACACTTGTGAGCTGC -3'
Posted On2017-02-10