Incidental Mutation 'R5847:Evc2'
ID453662
Institutional Source Beutler Lab
Gene Symbol Evc2
Ensembl Gene ENSMUSG00000050248
Gene NameEvC ciliary complex subunit 2
SynonymsLbn, limbin
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location37338499-37425055 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 37404724 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056365]
Predicted Effect probably benign
Transcript: ENSMUST00000056365
SMART Domains Protein: ENSMUSP00000055130
Gene: ENSMUSG00000050248

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
Pfam:EVC2_like 147 570 2.1e-191 PFAM
low complexity region 576 600 N/A INTRINSIC
coiled coil region 617 644 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 922 956 N/A INTRINSIC
low complexity region 1057 1071 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079794
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, short limbs and ribs, decreased osteoblast differentiation and abnormal chondrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Evc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Evc2 APN 5 37421891 missense probably benign 0.26
IGL01294:Evc2 APN 5 37347510 critical splice donor site probably null
IGL01547:Evc2 APN 5 37393087 missense probably benign 0.09
IGL02233:Evc2 APN 5 37378337 missense probably damaging 0.99
IGL02253:Evc2 APN 5 37378427 splice site probably benign
IGL02993:Evc2 APN 5 37419157 missense probably benign 0.01
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0324:Evc2 UTSW 5 37393099 missense probably damaging 1.00
R0441:Evc2 UTSW 5 37417467 missense probably damaging 1.00
R0454:Evc2 UTSW 5 37417484 missense possibly damaging 0.78
R1291:Evc2 UTSW 5 37386815 missense probably damaging 1.00
R1433:Evc2 UTSW 5 37393083 missense probably damaging 1.00
R1485:Evc2 UTSW 5 37370556 missense probably benign 0.30
R1491:Evc2 UTSW 5 37393197 critical splice donor site probably null
R1502:Evc2 UTSW 5 37393096 missense probably benign
R1662:Evc2 UTSW 5 37348750 missense probably benign 0.00
R1891:Evc2 UTSW 5 37392079 missense probably damaging 1.00
R1965:Evc2 UTSW 5 37363532 missense possibly damaging 0.73
R1983:Evc2 UTSW 5 37415931 nonsense probably null
R2160:Evc2 UTSW 5 37380518 missense possibly damaging 0.87
R2237:Evc2 UTSW 5 37378183 missense probably benign 0.22
R3926:Evc2 UTSW 5 37383230 missense probably damaging 1.00
R3953:Evc2 UTSW 5 37380587 critical splice donor site probably null
R3959:Evc2 UTSW 5 37415776 missense possibly damaging 0.63
R4281:Evc2 UTSW 5 37338594 missense probably benign 0.33
R4366:Evc2 UTSW 5 37338669 missense possibly damaging 0.93
R4707:Evc2 UTSW 5 37421860 missense probably benign 0.08
R4754:Evc2 UTSW 5 37387031 missense probably damaging 0.99
R5373:Evc2 UTSW 5 37378210 missense probably damaging 1.00
R5593:Evc2 UTSW 5 37386977 missense probably damaging 0.99
R5697:Evc2 UTSW 5 37370608 missense probably damaging 1.00
R5874:Evc2 UTSW 5 37417539 intron probably benign
R6023:Evc2 UTSW 5 37348616 missense probably benign 0.13
R6285:Evc2 UTSW 5 37424579 missense possibly damaging 0.86
R6394:Evc2 UTSW 5 37378275 missense probably damaging 1.00
R6567:Evc2 UTSW 5 37419164 missense probably benign 0.17
R6669:Evc2 UTSW 5 37378378 missense possibly damaging 0.88
R7039:Evc2 UTSW 5 37421888 missense probably damaging 1.00
R7131:Evc2 UTSW 5 37410258 missense probably damaging 1.00
R7144:Evc2 UTSW 5 37386839 missense probably damaging 0.97
R7372:Evc2 UTSW 5 37387133 missense probably damaging 0.98
R7376:Evc2 UTSW 5 37370639 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CTGGTGGGCAATGTTGACAG -3'
(R):5'- CTTTTGGCTCAGAGGAAGCTAC -3'

Sequencing Primer
(F):5'- GGGCAATGTTGACAGTTTCATC -3'
(R):5'- CAGAGGAAGCTACTGTGCAACTTTC -3'
Posted On2017-02-10