Mutagenetix > Incidental Mutations

Incidental Mutation 'R5847:Evc2'

453662

Institutional Source

Beutler Lab

Gene Symbol

Evc2

Ensembl Gene

ENSMUSG00000050248

Gene Name

EvC ciliary complex subunit 2

Synonyms

Lbn, limbin

MMRRC Submission

044065-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37338499-37425055 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 37404724 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000055130 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056365]

Predicted Effect

probably benign
Transcript: ENSMUST00000056365

SMART Domains

Protein: ENSMUSP00000055130
Gene: ENSMUSG00000050248

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	40	59	N/A	INTRINSIC
Pfam:EVC2_like	147	570	2.1e-191	PFAM
low complexity region	576	600	N/A	INTRINSIC
coiled coil region	617	644	N/A	INTRINSIC
low complexity region	780	791	N/A	INTRINSIC
low complexity region	902	914	N/A	INTRINSIC
coiled coil region	922	956	N/A	INTRINSIC
low complexity region	1057	1071	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000079794

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, short limbs and ribs, decreased osteoblast differentiation and abnormal chondrocyte physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	A	6: 48,933,478	F701L	probably damaging	Het
4931409K22Rik	A	T	5: 24,544,166	L778Q	probably benign	Het
Adgrg6	T	A	10: 14,426,777	Y964F	probably damaging	Het
Akap3	T	A	6: 126,865,558	L380Q	probably damaging	Het
Alpk1	A	G	3: 127,680,074	I760T	probably benign	Het
Arhgap20	G	A	9: 51,824,976		probably benign	Het
Cacng3	T	C	7: 122,762,309	F113S	possibly damaging	Het
Ccdc158	G	T	5: 92,627,480	N955K	probably benign	Het
Ccdc63	T	A	5: 122,116,845	M368L	possibly damaging	Het
Cnot2	T	C	10: 116,527,946	T18A	probably damaging	Het
Ctnna2	A	T	6: 76,973,837	D550E	possibly damaging	Het
Cyp2c37	C	T	19: 40,011,732	R433W	probably damaging	Het
Dact2	A	G	17: 14,199,188	S103P	probably damaging	Het
Dek	A	G	13: 47,101,601		probably benign	Het
Dnah9	CAGTTGCTTAAA	CA	11: 66,095,240		probably null	Het
Dock4	A	G	12: 40,621,251	Y23C	probably damaging	Het
Edar	T	A	10: 58,603,179	S344C	probably damaging	Het
Epg5	T	C	18: 78,030,055	V2431A	probably benign	Het
Idh3b	A	T	2: 130,284,028	D41E	probably benign	Het
Igkv8-24	A	T	6: 70,216,972	V84D	probably damaging	Het
Mgam	T	C	6: 40,684,055	I1118T	probably benign	Het
Mtmr3	A	G	11: 4,482,925	V1116A	probably damaging	Het
Myoc	A	G	1: 162,639,367	Y35C	probably damaging	Het
Ncr1	A	T	7: 4,344,574	D246V	probably benign	Het
Nphp3	A	G	9: 104,003,037	E86G	probably damaging	Het
Olfr1097	A	C	2: 86,890,332	V281G	probably damaging	Het
Olfr168	A	T	16: 19,530,326	V198E	probably damaging	Het
Olfr678	A	T	7: 105,069,857	Y130F	probably benign	Het
Pbld1	A	T	10: 63,076,414	I275L	probably benign	Het
Pde12	A	G	14: 26,665,631	V574A	possibly damaging	Het
Pdxk	G	T	10: 78,445,038	D189E	probably benign	Het
Pkhd1	C	A	1: 20,374,736	E2276*	probably null	Het
Ppp1r10	A	G	17: 35,926,847	N237S	possibly damaging	Het
Rheb	T	A	5: 24,807,069	Y131F	probably benign	Het
Rpgrip1l	T	C	8: 91,304,985	D88G	probably damaging	Het
Scgb2b33	T	C	7: 33,112,814		noncoding transcript	Het
Snx9	C	A	17: 5,924,621	N461K	possibly damaging	Het
Tbc1d2b	C	A	9: 90,209,724	V842F	probably damaging	Het
Tgfbi	G	A	13: 56,636,605	E615K	possibly damaging	Het
Tmem51	A	G	4: 142,032,035	M134T	probably damaging	Het
Tox4	A	G	14: 52,286,784	D125G	probably damaging	Het
Trappc3	A	T	4: 126,273,978	N110I	probably damaging	Het
Trim11	T	A	11: 58,990,593	D437E	probably damaging	Het
Ttc23l	T	C	15: 10,537,596	N196S	probably benign	Het
Wnk1	C	A	6: 119,992,408	G362V	probably damaging	Het
Wwc1	A	G	11: 35,867,326	F731S	probably damaging	Het
Wwp1	A	T	4: 19,662,174	D140E	possibly damaging	Het
Zfp24	G	A	18: 24,018,038	P17L	possibly damaging	Het
Zfp354b	T	C	11: 50,923,216	E294G	probably damaging	Het
Zfp853	C	T	5: 143,288,669	V399M	unknown	Het
Zfp868	T	C	8: 69,611,652	H344R	probably damaging	Het

Other mutations in Evc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00663:Evc2	APN	5	37421891	missense	probably benign	0.26
IGL01294:Evc2	APN	5	37347510	critical splice donor site	probably null
IGL01547:Evc2	APN	5	37393087	missense	probably benign	0.09
IGL02233:Evc2	APN	5	37378337	missense	probably damaging	0.99
IGL02253:Evc2	APN	5	37378427	splice site	probably benign
IGL02993:Evc2	APN	5	37419157	missense	probably benign	0.01
R0010:Evc2	UTSW	5	37417449	missense	probably damaging	1.00
R0010:Evc2	UTSW	5	37417449	missense	probably damaging	1.00
R0324:Evc2	UTSW	5	37393099	missense	probably damaging	1.00
R0441:Evc2	UTSW	5	37417467	missense	probably damaging	1.00
R0454:Evc2	UTSW	5	37417484	missense	possibly damaging	0.78
R1291:Evc2	UTSW	5	37386815	missense	probably damaging	1.00
R1433:Evc2	UTSW	5	37393083	missense	probably damaging	1.00
R1485:Evc2	UTSW	5	37370556	missense	probably benign	0.30
R1491:Evc2	UTSW	5	37393197	critical splice donor site	probably null
R1502:Evc2	UTSW	5	37393096	missense	probably benign
R1662:Evc2	UTSW	5	37348750	missense	probably benign	0.00
R1891:Evc2	UTSW	5	37392079	missense	probably damaging	1.00
R1965:Evc2	UTSW	5	37363532	missense	possibly damaging	0.73
R1983:Evc2	UTSW	5	37415931	nonsense	probably null
R2160:Evc2	UTSW	5	37380518	missense	possibly damaging	0.87
R2237:Evc2	UTSW	5	37378183	missense	probably benign	0.22
R3926:Evc2	UTSW	5	37383230	missense	probably damaging	1.00
R3953:Evc2	UTSW	5	37380587	critical splice donor site	probably null
R3959:Evc2	UTSW	5	37415776	missense	possibly damaging	0.63
R4281:Evc2	UTSW	5	37338594	missense	probably benign	0.33
R4366:Evc2	UTSW	5	37338669	missense	possibly damaging	0.93
R4707:Evc2	UTSW	5	37421860	missense	probably benign	0.08
R4754:Evc2	UTSW	5	37387031	missense	probably damaging	0.99
R5373:Evc2	UTSW	5	37378210	missense	probably damaging	1.00
R5593:Evc2	UTSW	5	37386977	missense	probably damaging	0.99
R5697:Evc2	UTSW	5	37370608	missense	probably damaging	1.00
R5874:Evc2	UTSW	5	37417539	intron	probably benign
R6023:Evc2	UTSW	5	37348616	missense	probably benign	0.13
R6285:Evc2	UTSW	5	37424579	missense	possibly damaging	0.86
R6394:Evc2	UTSW	5	37378275	missense	probably damaging	1.00
R6567:Evc2	UTSW	5	37419164	missense	probably benign	0.17
R6669:Evc2	UTSW	5	37378378	missense	possibly damaging	0.88
R7039:Evc2	UTSW	5	37421888	missense	probably damaging	1.00
R7131:Evc2	UTSW	5	37410258	missense	probably damaging	1.00
R7144:Evc2	UTSW	5	37386839	missense	probably damaging	0.97
R7372:Evc2	UTSW	5	37387133	missense	probably damaging	0.98
R7376:Evc2	UTSW	5	37370639	missense	possibly damaging	0.57
R7607:Evc2	UTSW	5	37386856	missense	possibly damaging	0.94
R7915:Evc2	UTSW	5	37386862	missense	probably damaging	0.98
R8144:Evc2	UTSW	5	37380567	missense	probably damaging	1.00
R8506:Evc2	UTSW	5	37383142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGTGGGCAATGTTGACAG -3'
(R):5'- CTTTTGGCTCAGAGGAAGCTAC -3'

Sequencing Primer
(F):5'- GGGCAATGTTGACAGTTTCATC -3'
(R):5'- CAGAGGAAGCTACTGTGCAACTTTC -3'

Posted On

2017-02-10