Incidental Mutation 'R5847:Ccdc158'
ID453663
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5847 (G1)
Quality Score210
Status Validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92627480 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 955 (N955K)
Ref Sequence ENSEMBL: ENSMUSP00000063050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930]
Predicted Effect probably benign
Transcript: ENSMUST00000060930
AA Change: N955K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050
AA Change: N955K

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1219:Ccdc158 UTSW 5 92654181 splice site probably benign
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2172:Ccdc158 UTSW 5 92632508 missense probably damaging 1.00
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3004:Ccdc158 UTSW 5 92649070 missense probably damaging 1.00
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4080:Ccdc158 UTSW 5 92623396 missense probably benign 0.00
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4483:Ccdc158 UTSW 5 92633328 missense probably benign 0.01
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6743:Ccdc158 UTSW 5 92662146 missense probably benign 0.08
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R6975:Ccdc158 UTSW 5 92666720 nonsense probably null
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATTCCATGGGCCTAGGACAG -3'
(R):5'- ACAGCCCTGGGTTCAATTCC -3'

Sequencing Primer
(F):5'- GCCTAGGACAGCACATTTGGTAC -3'
(R):5'- TCAAGACAGGGTCTCACTATGTAGC -3'
Posted On2017-02-10