Incidental Mutation 'R5847:Tbc1d2b'
ID453681
Institutional Source Beutler Lab
Gene Symbol Tbc1d2b
Ensembl Gene ENSMUSG00000037410
Gene NameTBC1 domain family, member 2B
Synonyms1810061M12Rik
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location90202027-90270804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90209724 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 842 (V842F)
Ref Sequence ENSEMBL: ENSMUSP00000045413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041767] [ENSMUST00000167122]
Predicted Effect probably damaging
Transcript: ENSMUST00000041767
AA Change: V842F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045413
Gene: ENSMUSG00000037410
AA Change: V842F

DomainStartEndE-ValueType
PH 35 141 2.66e-9 SMART
low complexity region 324 334 N/A INTRINSIC
low complexity region 343 356 N/A INTRINSIC
Blast:TBC 358 601 2e-25 BLAST
TBC 661 881 3.75e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167122
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Meta Mutation Damage Score 0.8334 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Tbc1d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Tbc1d2b APN 9 90226209 missense probably benign
IGL00791:Tbc1d2b APN 9 90227428 missense probably benign 0.18
IGL01457:Tbc1d2b APN 9 90205091 missense probably damaging 1.00
IGL01535:Tbc1d2b APN 9 90215473 splice site probably benign
IGL02089:Tbc1d2b APN 9 90222359 missense possibly damaging 0.80
IGL02409:Tbc1d2b APN 9 90222352 missense probably benign 0.00
IGL02799:Tbc1d2b APN 9 90223434 splice site probably benign
IGL03198:Tbc1d2b APN 9 90222457 missense probably damaging 1.00
Leone UTSW 9 90207887 missense probably damaging 1.00
panthera UTSW 9 90226248 missense probably benign
pardo UTSW 9 90219144 missense probably benign 0.13
pardus UTSW 9 90219010 nonsense probably null
roar UTSW 9 90218922 nonsense probably null
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0671:Tbc1d2b UTSW 9 90222505 splice site probably benign
R0682:Tbc1d2b UTSW 9 90249862 missense probably benign 0.01
R1074:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1075:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1140:Tbc1d2b UTSW 9 90226376 missense possibly damaging 0.91
R1892:Tbc1d2b UTSW 9 90218943 missense probably damaging 0.98
R4064:Tbc1d2b UTSW 9 90218922 nonsense probably null
R4541:Tbc1d2b UTSW 9 90205169 missense probably damaging 1.00
R4590:Tbc1d2b UTSW 9 90270500 missense possibly damaging 0.81
R4651:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4652:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4971:Tbc1d2b UTSW 9 90218870 missense probably benign 0.00
R5086:Tbc1d2b UTSW 9 90227457 missense probably benign
R5131:Tbc1d2b UTSW 9 90209759 missense probably damaging 1.00
R5205:Tbc1d2b UTSW 9 90207810 missense probably damaging 1.00
R5502:Tbc1d2b UTSW 9 90227443 missense probably benign
R5509:Tbc1d2b UTSW 9 90218969 missense probably damaging 1.00
R5534:Tbc1d2b UTSW 9 90227506 missense possibly damaging 0.89
R5729:Tbc1d2b UTSW 9 90207872 missense probably benign 0.22
R5735:Tbc1d2b UTSW 9 90222409 missense possibly damaging 0.71
R5928:Tbc1d2b UTSW 9 90219144 missense probably benign 0.13
R6595:Tbc1d2b UTSW 9 90226092 missense probably benign 0.02
R6766:Tbc1d2b UTSW 9 90226209 missense probably benign
R7563:Tbc1d2b UTSW 9 90219010 nonsense probably null
R7563:Tbc1d2b UTSW 9 90226248 missense probably benign
R8126:Tbc1d2b UTSW 9 90222316 missense probably benign 0.00
X0066:Tbc1d2b UTSW 9 90218658 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACAGGGAGGTAAGTTTGGTGC -3'
(R):5'- CAGAAGAGCTGTGTTGCTGC -3'

Sequencing Primer
(F):5'- TGCTGTGGTAACCTCACAAG -3'
(R):5'- TCTGCTCTCAGGTGGCACAG -3'
Posted On2017-02-10