Mutagenetix > Incidental Mutation

Incidental Mutation 'R5847:Adgrg6'

453682

Institutional Source

Beutler Lab

Gene Symbol

Adgrg6

Ensembl Gene

ENSMUSG00000039116

Gene Name

adhesion G protein-coupled receptor G6

Synonyms

LOC215798, 1190004A11Rik, DREG, Gpr126

MMRRC Submission

044065-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14402583-14545659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14426777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 964 (Y964F)

Ref Sequence

ENSEMBL: ENSMUSP00000146821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041168] [ENSMUST00000208429]

AlphaFold

Q6F3F9

Predicted Effect

probably damaging
Transcript: ENSMUST00000041168
AA Change: Y936F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000043055
Gene: ENSMUSG00000039116
AA Change: Y936F

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
CUB	41	149	8.59e-33	SMART
low complexity region	609	620	N/A	INTRINSIC
low complexity region	695	706	N/A	INTRINSIC
GPS	769	822	2.48e-12	SMART
Pfam:7tm_2	831	1080	4.1e-52	PFAM
low complexity region	1122	1154	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000208429
AA Change: Y964F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2212

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is upregulated in human umbilical vein endothelial cells, encodes a G protein-coupled receptor. Variations in this gene can affect a person's stature. Multiple transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation die during organogenesis and display signs of circulatory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	A	6: 48,933,478	F701L	probably damaging	Het
4931409K22Rik	A	T	5: 24,544,166	L778Q	probably benign	Het
Akap3	T	A	6: 126,865,558	L380Q	probably damaging	Het
Alpk1	A	G	3: 127,680,074	I760T	probably benign	Het
Arhgap20	G	A	9: 51,824,976		probably benign	Het
Cacng3	T	C	7: 122,762,309	F113S	possibly damaging	Het
Ccdc158	G	T	5: 92,627,480	N955K	probably benign	Het
Ccdc63	T	A	5: 122,116,845	M368L	possibly damaging	Het
Cnot2	T	C	10: 116,527,946	T18A	probably damaging	Het
Ctnna2	A	T	6: 76,973,837	D550E	possibly damaging	Het
Cyp2c37	C	T	19: 40,011,732	R433W	probably damaging	Het
Dact2	A	G	17: 14,199,188	S103P	probably damaging	Het
Dek	A	G	13: 47,101,601		probably benign	Het
Dnah9	CAGTTGCTTAAA	CA	11: 66,095,240		probably null	Het
Dock4	A	G	12: 40,621,251	Y23C	probably damaging	Het
Edar	T	A	10: 58,603,179	S344C	probably damaging	Het
Epg5	T	C	18: 78,030,055	V2431A	probably benign	Het
Evc2	C	T	5: 37,404,724		probably benign	Het
Idh3b	A	T	2: 130,284,028	D41E	probably benign	Het
Igkv8-24	A	T	6: 70,216,972	V84D	probably damaging	Het
Mgam	T	C	6: 40,684,055	I1118T	probably benign	Het
Mtmr3	A	G	11: 4,482,925	V1116A	probably damaging	Het
Myoc	A	G	1: 162,639,367	Y35C	probably damaging	Het
Ncr1	A	T	7: 4,344,574	D246V	probably benign	Het
Nphp3	A	G	9: 104,003,037	E86G	probably damaging	Het
Olfr1097	A	C	2: 86,890,332	V281G	probably damaging	Het
Olfr168	A	T	16: 19,530,326	V198E	probably damaging	Het
Olfr678	A	T	7: 105,069,857	Y130F	probably benign	Het
Pbld1	A	T	10: 63,076,414	I275L	probably benign	Het
Pde12	A	G	14: 26,665,631	V574A	possibly damaging	Het
Pdxk	G	T	10: 78,445,038	D189E	probably benign	Het
Pkhd1	C	A	1: 20,374,736	E2276*	probably null	Het
Ppp1r10	A	G	17: 35,926,847	N237S	possibly damaging	Het
Rheb	T	A	5: 24,807,069	Y131F	probably benign	Het
Rpgrip1l	T	C	8: 91,304,985	D88G	probably damaging	Het
Scgb2b33	T	C	7: 33,112,814		noncoding transcript	Het
Snx9	C	A	17: 5,924,621	N461K	possibly damaging	Het
Tbc1d2b	C	A	9: 90,209,724	V842F	probably damaging	Het
Tgfbi	G	A	13: 56,636,605	E615K	possibly damaging	Het
Tmem51	A	G	4: 142,032,035	M134T	probably damaging	Het
Tox4	A	G	14: 52,286,784	D125G	probably damaging	Het
Trappc3	A	T	4: 126,273,978	N110I	probably damaging	Het
Trim11	T	A	11: 58,990,593	D437E	probably damaging	Het
Ttc23l	T	C	15: 10,537,596	N196S	probably benign	Het
Wnk1	C	A	6: 119,992,408	G362V	probably damaging	Het
Wwc1	A	G	11: 35,867,326	F731S	probably damaging	Het
Wwp1	A	T	4: 19,662,174	D140E	possibly damaging	Het
Zfp24	G	A	18: 24,018,038	P17L	possibly damaging	Het
Zfp354b	T	C	11: 50,923,216	E294G	probably damaging	Het
Zfp853	C	T	5: 143,288,669	V399M	unknown	Het
Zfp868	T	C	8: 69,611,652	H344R	probably damaging	Het

Other mutations in Adgrg6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Adgrg6	APN	10	14467450	missense	probably damaging	0.99
IGL00428:Adgrg6	APN	10	14467375	missense	probably benign
IGL00489:Adgrg6	APN	10	14440403	splice site	probably null
IGL00496:Adgrg6	APN	10	14450578	critical splice donor site	probably null
IGL00743:Adgrg6	APN	10	14535959	splice site	probably benign
IGL01011:Adgrg6	APN	10	14409798	missense	probably damaging	0.96
IGL01291:Adgrg6	APN	10	14410530	missense	possibly damaging	0.92
IGL01453:Adgrg6	APN	10	14420458	missense	possibly damaging	0.94
IGL01594:Adgrg6	APN	10	14434340	missense	probably damaging	1.00
IGL02013:Adgrg6	APN	10	14426811	missense	probably damaging	0.98
IGL02037:Adgrg6	APN	10	14441441	missense	probably damaging	0.98
IGL02070:Adgrg6	APN	10	14467592	missense	probably damaging	1.00
IGL02164:Adgrg6	APN	10	14523555	intron	probably benign
IGL02262:Adgrg6	APN	10	14441396	missense	probably benign	0.00
IGL02272:Adgrg6	APN	10	14468829	missense	probably damaging	1.00
IGL02605:Adgrg6	APN	10	14467232	missense	probably damaging	1.00
IGL02800:Adgrg6	APN	10	14420605	missense	probably damaging	1.00
IGL03175:Adgrg6	APN	10	14439758	missense	probably benign	0.04
ANU05:Adgrg6	UTSW	10	14410530	missense	possibly damaging	0.92
R0245:Adgrg6	UTSW	10	14458066	splice site	probably benign
R0356:Adgrg6	UTSW	10	14426898	missense	possibly damaging	0.47
R0388:Adgrg6	UTSW	10	14450658	missense	probably benign	0.00
R0508:Adgrg6	UTSW	10	14450616	missense	probably benign	0.32
R0626:Adgrg6	UTSW	10	14436884	missense	probably damaging	1.00
R1116:Adgrg6	UTSW	10	14438428	missense	probably benign	0.00
R1205:Adgrg6	UTSW	10	14434339	missense	probably damaging	1.00
R1438:Adgrg6	UTSW	10	14468841	missense	possibly damaging	0.68
R1599:Adgrg6	UTSW	10	14467313	nonsense	probably null
R1714:Adgrg6	UTSW	10	14439770	missense	possibly damaging	0.64
R1728:Adgrg6	UTSW	10	14439782	missense	probably damaging	1.00
R1729:Adgrg6	UTSW	10	14439782	missense	probably damaging	1.00
R1784:Adgrg6	UTSW	10	14439782	missense	probably damaging	1.00
R2124:Adgrg6	UTSW	10	14467186	missense	probably damaging	0.98
R2906:Adgrg6	UTSW	10	14432950	missense	probably benign	0.03
R3410:Adgrg6	UTSW	10	14440370	missense	probably benign	0.10
R3982:Adgrg6	UTSW	10	14448845	missense	probably benign	0.10
R4376:Adgrg6	UTSW	10	14438494	missense	probably benign	0.02
R4376:Adgrg6	UTSW	10	14469050	missense	probably damaging	1.00
R4445:Adgrg6	UTSW	10	14409763	missense	probably damaging	1.00
R4446:Adgrg6	UTSW	10	14409763	missense	probably damaging	1.00
R4472:Adgrg6	UTSW	10	14436781	missense	probably damaging	1.00
R4622:Adgrg6	UTSW	10	14441499	missense	probably damaging	1.00
R4623:Adgrg6	UTSW	10	14441499	missense	probably damaging	1.00
R4649:Adgrg6	UTSW	10	14468827	missense	probably damaging	1.00
R4882:Adgrg6	UTSW	10	14434337	missense	possibly damaging	0.88
R4978:Adgrg6	UTSW	10	14420461	missense	probably damaging	1.00
R5246:Adgrg6	UTSW	10	14426765	missense	probably damaging	1.00
R5420:Adgrg6	UTSW	10	14426986	nonsense	probably null
R5461:Adgrg6	UTSW	10	14420504	missense	probably damaging	1.00
R5580:Adgrg6	UTSW	10	14410484	nonsense	probably null
R5644:Adgrg6	UTSW	10	14432934	missense	probably damaging	1.00
R5900:Adgrg6	UTSW	10	14438419	critical splice donor site	probably null
R6302:Adgrg6	UTSW	10	14441483	missense	probably benign	0.22
R6318:Adgrg6	UTSW	10	14467497	missense	probably benign
R6319:Adgrg6	UTSW	10	14431622	missense	probably damaging	1.00
R6339:Adgrg6	UTSW	10	14434347	missense	probably damaging	1.00
R6683:Adgrg6	UTSW	10	14456167	missense	probably damaging	0.97
R6983:Adgrg6	UTSW	10	14431695	missense	probably damaging	1.00
R7337:Adgrg6	UTSW	10	14467351	missense	possibly damaging	0.82
R7378:Adgrg6	UTSW	10	14535892	missense	probably benign	0.16
R7463:Adgrg6	UTSW	10	14434396	missense	possibly damaging	0.82
R7470:Adgrg6	UTSW	10	14444066	missense	probably benign
R7558:Adgrg6	UTSW	10	14431607	missense	probably damaging	1.00
R7593:Adgrg6	UTSW	10	14468829	missense	probably damaging	1.00
R7747:Adgrg6	UTSW	10	14450577	critical splice donor site	probably null
R7768:Adgrg6	UTSW	10	14431666	missense	probably benign	0.00
R7962:Adgrg6	UTSW	10	14420684	missense	probably damaging	1.00
R8049:Adgrg6	UTSW	10	14428199	missense	probably benign	0.00
R8059:Adgrg6	UTSW	10	14469050	missense	probably damaging	0.99
R8373:Adgrg6	UTSW	10	14467334	missense	probably benign	0.03
R8406:Adgrg6	UTSW	10	14467338	missense	probably benign	0.05
R8722:Adgrg6	UTSW	10	14420444	missense	probably benign	0.35
R9046:Adgrg6	UTSW	10	14448114	missense	probably benign
R9422:Adgrg6	UTSW	10	14426996	missense	probably damaging	1.00
R9482:Adgrg6	UTSW	10	14431679	missense	probably benign	0.11
R9682:Adgrg6	UTSW	10	14440384	missense	possibly damaging	0.49
R9764:Adgrg6	UTSW	10	14426771	missense	probably benign	0.05
R9794:Adgrg6	UTSW	10	14438452	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTACTGGTAAGGGTTTCAAAAC -3'
(R):5'- AAGCTGCGCAGGGATTATCC -3'

Sequencing Primer
(F):5'- GTTTCAAAACCACACAGTGCTGG -3'
(R):5'- AATCCTGATGAATCTGAGCTCGGC -3'

Posted On

2017-02-10