Incidental Mutation 'R5847:Cnot2'
ID 453685
Institutional Source Beutler Lab
Gene Symbol Cnot2
Ensembl Gene ENSMUSG00000020166
Gene Name CCR4-NOT transcription complex, subunit 2
Synonyms 2600016M12Rik, 2810470K03Rik
MMRRC Submission 044065-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.894) question?
Stock # R5847 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 116321066-116417416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116363851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 18 (T18A)
Ref Sequence ENSEMBL: ENSMUSP00000151501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020374] [ENSMUST00000105265] [ENSMUST00000105267] [ENSMUST00000164088] [ENSMUST00000167706] [ENSMUST00000169507] [ENSMUST00000169921] [ENSMUST00000218490] [ENSMUST00000218744] [ENSMUST00000168036] [ENSMUST00000169576]
AlphaFold Q8C5L3
Predicted Effect possibly damaging
Transcript: ENSMUST00000020374
AA Change: T18A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000105265
SMART Domains Protein: ENSMUSP00000100900
Gene: ENSMUSG00000020166

DomainStartEndE-ValueType
low complexity region 68 87 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
Pfam:NOT2_3_5 310 437 1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105267
AA Change: T18A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100902
Gene: ENSMUSG00000020166
AA Change: T18A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 396 521 8.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164088
SMART Domains Protein: ENSMUSP00000127830
Gene: ENSMUSG00000020166

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167644
Predicted Effect probably benign
Transcript: ENSMUST00000167706
AA Change: T18A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128837
Gene: ENSMUSG00000020166
AA Change: T18A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:NOT2_3_5 345 472 2.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171944
Predicted Effect unknown
Transcript: ENSMUST00000169507
AA Change: D37G
Predicted Effect probably benign
Transcript: ENSMUST00000169921
AA Change: T18A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132152
Gene: ENSMUSG00000020166
AA Change: T18A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 395 522 1.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171214
Predicted Effect unknown
Transcript: ENSMUST00000218490
AA Change: D37G
Predicted Effect probably damaging
Transcript: ENSMUST00000218744
AA Change: T18A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000168036
SMART Domains Protein: ENSMUSP00000132315
Gene: ENSMUSG00000020166

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220305
Predicted Effect probably benign
Transcript: ENSMUST00000169576
Meta Mutation Damage Score 0.2713 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-component CCR4-NOT complex. The CCR4-NOT complex regulates mRNA synthesis and degradation and is also thought to be involved in mRNA splicing, transport and localization. The encoded protein interacts with histone deacetylases and functions as a repressor of polymerase II transcription. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T A 10: 14,302,521 (GRCm39) Y964F probably damaging Het
Akap3 T A 6: 126,842,521 (GRCm39) L380Q probably damaging Het
Alpk1 A G 3: 127,473,723 (GRCm39) I760T probably benign Het
Aoc1l2 T A 6: 48,910,412 (GRCm39) F701L probably damaging Het
Arhgap20 G A 9: 51,736,276 (GRCm39) probably benign Het
Cacng3 T C 7: 122,361,532 (GRCm39) F113S possibly damaging Het
Ccdc158 G T 5: 92,775,339 (GRCm39) N955K probably benign Het
Ccdc63 T A 5: 122,254,908 (GRCm39) M368L possibly damaging Het
Ctnna2 A T 6: 76,950,820 (GRCm39) D550E possibly damaging Het
Cyp2c37 C T 19: 40,000,176 (GRCm39) R433W probably damaging Het
Dact2 A G 17: 14,419,450 (GRCm39) S103P probably damaging Het
Dek A G 13: 47,255,077 (GRCm39) probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 65,986,066 (GRCm39) probably null Het
Dock4 A G 12: 40,671,250 (GRCm39) Y23C probably damaging Het
Edar T A 10: 58,439,001 (GRCm39) S344C probably damaging Het
Epg5 T C 18: 78,073,270 (GRCm39) V2431A probably benign Het
Evc2 C T 5: 37,562,068 (GRCm39) probably benign Het
Idh3b A T 2: 130,125,948 (GRCm39) D41E probably benign Het
Igkv8-24 A T 6: 70,193,956 (GRCm39) V84D probably damaging Het
Iqca1l A T 5: 24,749,164 (GRCm39) L778Q probably benign Het
Mgam T C 6: 40,660,989 (GRCm39) I1118T probably benign Het
Mtmr3 A G 11: 4,432,925 (GRCm39) V1116A probably damaging Het
Myoc A G 1: 162,466,936 (GRCm39) Y35C probably damaging Het
Ncr1 A T 7: 4,347,573 (GRCm39) D246V probably benign Het
Nphp3 A G 9: 103,880,236 (GRCm39) E86G probably damaging Het
Or2l13b A T 16: 19,349,076 (GRCm39) V198E probably damaging Het
Or52e5 A T 7: 104,719,064 (GRCm39) Y130F probably benign Het
Or8h7 A C 2: 86,720,676 (GRCm39) V281G probably damaging Het
Pbld1 A T 10: 62,912,193 (GRCm39) I275L probably benign Het
Pde12 A G 14: 26,386,786 (GRCm39) V574A possibly damaging Het
Pdxk G T 10: 78,280,872 (GRCm39) D189E probably benign Het
Pkhd1 C A 1: 20,444,960 (GRCm39) E2276* probably null Het
Ppp1r10 A G 17: 36,237,739 (GRCm39) N237S possibly damaging Het
Rheb T A 5: 25,012,067 (GRCm39) Y131F probably benign Het
Rpgrip1l T C 8: 92,031,613 (GRCm39) D88G probably damaging Het
Scgb2b33 T C 7: 32,812,239 (GRCm39) noncoding transcript Het
Snx9 C A 17: 5,974,896 (GRCm39) N461K possibly damaging Het
Tbc1d2b C A 9: 90,091,777 (GRCm39) V842F probably damaging Het
Tgfbi G A 13: 56,784,418 (GRCm39) E615K possibly damaging Het
Tmem51 A G 4: 141,759,346 (GRCm39) M134T probably damaging Het
Tox4 A G 14: 52,524,241 (GRCm39) D125G probably damaging Het
Trappc3 A T 4: 126,167,771 (GRCm39) N110I probably damaging Het
Trim11 T A 11: 58,881,419 (GRCm39) D437E probably damaging Het
Ttc23l T C 15: 10,537,682 (GRCm39) N196S probably benign Het
Wnk1 C A 6: 119,969,369 (GRCm39) G362V probably damaging Het
Wwc1 A G 11: 35,758,153 (GRCm39) F731S probably damaging Het
Wwp1 A T 4: 19,662,174 (GRCm39) D140E possibly damaging Het
Zfp24 G A 18: 24,151,095 (GRCm39) P17L possibly damaging Het
Zfp354b T C 11: 50,814,043 (GRCm39) E294G probably damaging Het
Zfp853 C T 5: 143,274,424 (GRCm39) V399M unknown Het
Zfp868 T C 8: 70,064,303 (GRCm39) H344R probably damaging Het
Other mutations in Cnot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cnot2 APN 10 116,342,976 (GRCm39) missense probably benign 0.02
IGL02433:Cnot2 APN 10 116,328,241 (GRCm39) missense possibly damaging 0.82
IGL03066:Cnot2 APN 10 116,335,262 (GRCm39) missense probably benign 0.15
IGL03383:Cnot2 APN 10 116,330,722 (GRCm39) splice site probably benign
R0145:Cnot2 UTSW 10 116,353,273 (GRCm39) missense possibly damaging 0.90
R0497:Cnot2 UTSW 10 116,334,260 (GRCm39) missense probably damaging 1.00
R0615:Cnot2 UTSW 10 116,334,141 (GRCm39) missense possibly damaging 0.89
R1935:Cnot2 UTSW 10 116,334,320 (GRCm39) missense possibly damaging 0.62
R1985:Cnot2 UTSW 10 116,363,781 (GRCm39) missense probably damaging 0.99
R2148:Cnot2 UTSW 10 116,342,185 (GRCm39) missense probably benign 0.01
R4063:Cnot2 UTSW 10 116,373,301 (GRCm39) missense possibly damaging 0.46
R4179:Cnot2 UTSW 10 116,334,048 (GRCm39) missense possibly damaging 0.81
R4196:Cnot2 UTSW 10 116,337,209 (GRCm39) missense possibly damaging 0.62
R4523:Cnot2 UTSW 10 116,417,379 (GRCm39) unclassified probably benign
R4572:Cnot2 UTSW 10 116,330,751 (GRCm39) missense probably benign 0.37
R4610:Cnot2 UTSW 10 116,335,323 (GRCm39) missense probably damaging 1.00
R5219:Cnot2 UTSW 10 116,342,215 (GRCm39) splice site probably null
R6444:Cnot2 UTSW 10 116,335,260 (GRCm39) missense probably benign 0.02
R6733:Cnot2 UTSW 10 116,334,058 (GRCm39) missense possibly damaging 0.81
R6734:Cnot2 UTSW 10 116,334,058 (GRCm39) missense possibly damaging 0.81
R6735:Cnot2 UTSW 10 116,334,058 (GRCm39) missense possibly damaging 0.81
R6944:Cnot2 UTSW 10 116,373,128 (GRCm39) intron probably benign
R7139:Cnot2 UTSW 10 116,330,924 (GRCm39) missense probably benign 0.00
R7248:Cnot2 UTSW 10 116,334,278 (GRCm39) missense probably benign 0.05
R7423:Cnot2 UTSW 10 116,328,303 (GRCm39) missense probably damaging 1.00
R7526:Cnot2 UTSW 10 116,342,985 (GRCm39) missense probably benign 0.12
R7851:Cnot2 UTSW 10 116,373,337 (GRCm39) missense possibly damaging 0.66
R8245:Cnot2 UTSW 10 116,346,294 (GRCm39) missense probably benign 0.07
R8350:Cnot2 UTSW 10 116,322,181 (GRCm39) missense probably damaging 1.00
R8463:Cnot2 UTSW 10 116,353,236 (GRCm39) missense probably benign 0.11
R9045:Cnot2 UTSW 10 116,322,160 (GRCm39) missense probably benign 0.05
R9175:Cnot2 UTSW 10 116,334,051 (GRCm39) missense possibly damaging 0.94
R9229:Cnot2 UTSW 10 116,384,960 (GRCm39) nonsense probably null
R9343:Cnot2 UTSW 10 116,346,326 (GRCm39) missense
R9508:Cnot2 UTSW 10 116,329,616 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCTACACCTATGCTTAGC -3'
(R):5'- TGTGGGGCCGTGAAAATATACC -3'

Sequencing Primer
(F):5'- TATGCTTAGCACAGACAATCCCCTG -3'
(R):5'- GGGCCGTGAAAATATACCATATAGTC -3'
Posted On 2017-02-10