Incidental Mutation 'R5847:Cnot2'
ID453685
Institutional Source Beutler Lab
Gene Symbol Cnot2
Ensembl Gene ENSMUSG00000020166
Gene NameCCR4-NOT transcription complex, subunit 2
Synonyms2810470K03Rik, 2600016M12Rik
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116485161-116581511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116527946 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 18 (T18A)
Ref Sequence ENSEMBL: ENSMUSP00000151501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020374] [ENSMUST00000105265] [ENSMUST00000105267] [ENSMUST00000164088] [ENSMUST00000167706] [ENSMUST00000168036] [ENSMUST00000169507] [ENSMUST00000169576] [ENSMUST00000169921] [ENSMUST00000218490] [ENSMUST00000218744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020374
AA Change: T18A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000105265
SMART Domains Protein: ENSMUSP00000100900
Gene: ENSMUSG00000020166

DomainStartEndE-ValueType
low complexity region 68 87 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
Pfam:NOT2_3_5 310 437 1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105267
AA Change: T18A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100902
Gene: ENSMUSG00000020166
AA Change: T18A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 396 521 8.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164088
SMART Domains Protein: ENSMUSP00000127830
Gene: ENSMUSG00000020166

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167644
Predicted Effect probably benign
Transcript: ENSMUST00000167706
AA Change: T18A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128837
Gene: ENSMUSG00000020166
AA Change: T18A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:NOT2_3_5 345 472 2.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168036
SMART Domains Protein: ENSMUSP00000132315
Gene: ENSMUSG00000020166

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169507
AA Change: D37G
Predicted Effect probably benign
Transcript: ENSMUST00000169576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171944
Predicted Effect probably benign
Transcript: ENSMUST00000169921
AA Change: T18A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132152
Gene: ENSMUSG00000020166
AA Change: T18A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 395 522 1.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171214
Predicted Effect unknown
Transcript: ENSMUST00000218490
AA Change: D37G
Predicted Effect probably damaging
Transcript: ENSMUST00000218744
AA Change: T18A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220305
Meta Mutation Damage Score 0.2713 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-component CCR4-NOT complex. The CCR4-NOT complex regulates mRNA synthesis and degradation and is also thought to be involved in mRNA splicing, transport and localization. The encoded protein interacts with histone deacetylases and functions as a repressor of polymerase II transcription. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Cnot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cnot2 APN 10 116507071 missense probably benign 0.02
IGL02433:Cnot2 APN 10 116492336 missense possibly damaging 0.82
IGL03066:Cnot2 APN 10 116499357 missense probably benign 0.15
IGL03383:Cnot2 APN 10 116494817 splice site probably benign
R0145:Cnot2 UTSW 10 116517368 missense possibly damaging 0.90
R0497:Cnot2 UTSW 10 116498355 missense probably damaging 1.00
R0615:Cnot2 UTSW 10 116498236 missense possibly damaging 0.89
R1935:Cnot2 UTSW 10 116498415 missense possibly damaging 0.62
R1985:Cnot2 UTSW 10 116527876 missense probably damaging 0.99
R2148:Cnot2 UTSW 10 116506280 missense probably benign 0.01
R4063:Cnot2 UTSW 10 116537396 missense possibly damaging 0.46
R4179:Cnot2 UTSW 10 116498143 missense possibly damaging 0.81
R4196:Cnot2 UTSW 10 116501304 missense possibly damaging 0.62
R4523:Cnot2 UTSW 10 116581474 unclassified probably benign
R4572:Cnot2 UTSW 10 116494846 missense probably benign 0.37
R4610:Cnot2 UTSW 10 116499418 missense probably damaging 1.00
R5219:Cnot2 UTSW 10 116506310 splice site probably null
R6444:Cnot2 UTSW 10 116499355 missense probably benign 0.02
R6733:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6734:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6735:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6944:Cnot2 UTSW 10 116537223 intron probably benign
R7139:Cnot2 UTSW 10 116495019 missense probably benign 0.00
R7248:Cnot2 UTSW 10 116498373 missense probably benign 0.05
R7423:Cnot2 UTSW 10 116492398 missense probably damaging 1.00
R7526:Cnot2 UTSW 10 116507080 missense probably benign 0.12
R7851:Cnot2 UTSW 10 116537432 missense possibly damaging 0.66
R8245:Cnot2 UTSW 10 116510389 missense probably benign 0.07
R8350:Cnot2 UTSW 10 116486276 missense probably damaging 1.00
R8463:Cnot2 UTSW 10 116517331 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGGACCTACACCTATGCTTAGC -3'
(R):5'- TGTGGGGCCGTGAAAATATACC -3'

Sequencing Primer
(F):5'- TATGCTTAGCACAGACAATCCCCTG -3'
(R):5'- GGGCCGTGAAAATATACCATATAGTC -3'
Posted On2017-02-10