Incidental Mutation 'R5847:Mtmr3'
ID453686
Institutional Source Beutler Lab
Gene Symbol Mtmr3
Ensembl Gene ENSMUSG00000034354
Gene Namemyotubularin related protein 3
SynonymsFYVE-DSP1, 1700092A20Rik, ZFYVE10
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4480868-4594863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4482925 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1116 (V1116A)
Ref Sequence ENSEMBL: ENSMUSP00000116315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040448] [ENSMUST00000109943] [ENSMUST00000123506] [ENSMUST00000128256] [ENSMUST00000130716]
Predicted Effect probably damaging
Transcript: ENSMUST00000040448
AA Change: V1108A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049079
Gene: ENSMUSG00000034354
AA Change: V1108A

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109943
AA Change: V1108A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105569
Gene: ENSMUSG00000034354
AA Change: V1108A

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123506
AA Change: V1144A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122422
Gene: ENSMUSG00000034354
AA Change: V1144A

DomainStartEndE-ValueType
Pfam:Myotub-related 126 524 1e-138 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1108 1177 7.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128256
AA Change: V1116A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116315
Gene: ENSMUSG00000034354
AA Change: V1116A

DomainStartEndE-ValueType
Pfam:Myotub-related 125 526 7.7e-149 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1071 1149 1.42e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130716
SMART Domains Protein: ENSMUSP00000137687
Gene: ENSMUSG00000034354

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 2.2e-148 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155566
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased serum alkaline phosphatase level and, in males, impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Mtmr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Mtmr3 APN 11 4527861 missense probably damaging 1.00
IGL01808:Mtmr3 APN 11 4497404 missense probably damaging 1.00
IGL01994:Mtmr3 APN 11 4487938 missense probably benign
IGL02839:Mtmr3 APN 11 4487994 missense probably benign 0.03
IGL02893:Mtmr3 APN 11 4507632 missense possibly damaging 0.89
IGL03370:Mtmr3 APN 11 4487385 missense probably damaging 1.00
R0322:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R0363:Mtmr3 UTSW 11 4487536 missense probably damaging 0.99
R0655:Mtmr3 UTSW 11 4488610 missense probably damaging 1.00
R0866:Mtmr3 UTSW 11 4488474 missense probably benign 0.03
R1065:Mtmr3 UTSW 11 4492859 missense probably damaging 1.00
R1417:Mtmr3 UTSW 11 4487923 missense probably benign
R1698:Mtmr3 UTSW 11 4492825 missense possibly damaging 0.95
R1707:Mtmr3 UTSW 11 4504095 missense probably damaging 1.00
R2191:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R2192:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R3956:Mtmr3 UTSW 11 4491138 missense probably damaging 1.00
R4079:Mtmr3 UTSW 11 4491057 missense probably damaging 1.00
R4320:Mtmr3 UTSW 11 4487947 missense probably benign 0.39
R4577:Mtmr3 UTSW 11 4497375 missense probably damaging 1.00
R4622:Mtmr3 UTSW 11 4491067 missense possibly damaging 0.62
R4676:Mtmr3 UTSW 11 4527855 missense probably benign 0.12
R4726:Mtmr3 UTSW 11 4507634 missense probably damaging 1.00
R4781:Mtmr3 UTSW 11 4488435 missense probably benign 0.00
R4799:Mtmr3 UTSW 11 4487764 missense probably benign 0.12
R4810:Mtmr3 UTSW 11 4498046 missense probably benign 0.33
R5744:Mtmr3 UTSW 11 4487679 missense possibly damaging 0.47
R5933:Mtmr3 UTSW 11 4498951 missense probably benign
R6102:Mtmr3 UTSW 11 4487673 missense probably damaging 0.99
R6105:Mtmr3 UTSW 11 4485432 missense probably damaging 0.99
R6254:Mtmr3 UTSW 11 4497381 nonsense probably null
R6443:Mtmr3 UTSW 11 4487358 missense probably damaging 0.99
R6881:Mtmr3 UTSW 11 4489725 missense probably benign 0.33
R6941:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R6986:Mtmr3 UTSW 11 4489692 missense probably damaging 1.00
R7045:Mtmr3 UTSW 11 4498896 missense possibly damaging 0.94
T0975:Mtmr3 UTSW 11 4488441 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAAAGGAACAGCAGCATGGCC -3'
(R):5'- GCCACATGTCATCCTTGGTG -3'

Sequencing Primer
(F):5'- AGCAGCATGGCCTCTGC -3'
(R):5'- ATGACTGCACTGGGTAGACTTATC -3'
Posted On2017-02-10