Mutagenetix > Incidental Mutations

Incidental Mutation 'R5847:Mtmr3'

453686

Institutional Source

Beutler Lab

Gene Symbol

Mtmr3

Ensembl Gene

ENSMUSG00000034354

Gene Name

myotubularin related protein 3

Synonyms

FYVE-DSP1, 1700092A20Rik, ZFYVE10

MMRRC Submission

044065-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4480868-4594863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4482925 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1116 (V1116A)

Ref Sequence

ENSEMBL: ENSMUSP00000116315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040448] [ENSMUST00000109943] [ENSMUST00000123506] [ENSMUST00000128256] [ENSMUST00000130716]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040448
AA Change: V1108A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000049079
Gene: ENSMUSG00000034354
AA Change: V1108A

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	126	527	7.6e-149	PFAM
low complexity region	578	590	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
coiled coil region	1027	1058	N/A	INTRINSIC
FYVE	1072	1141	3.63e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109943
AA Change: V1108A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105569
Gene: ENSMUSG00000034354
AA Change: V1108A

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	126	527	7.6e-149	PFAM
low complexity region	578	590	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
coiled coil region	1027	1058	N/A	INTRINSIC
FYVE	1072	1141	3.63e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000123506
AA Change: V1144A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122422
Gene: ENSMUSG00000034354
AA Change: V1144A

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	126	524	1e-138	PFAM
low complexity region	577	589	N/A	INTRINSIC
low complexity region	820	831	N/A	INTRINSIC
coiled coil region	1026	1057	N/A	INTRINSIC
FYVE	1108	1177	7.77e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000128256
AA Change: V1116A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116315
Gene: ENSMUSG00000034354
AA Change: V1116A

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	125	526	7.7e-149	PFAM
low complexity region	577	589	N/A	INTRINSIC
low complexity region	820	831	N/A	INTRINSIC
coiled coil region	1026	1057	N/A	INTRINSIC
FYVE	1071	1149	1.42e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130716

SMART Domains

Protein: ENSMUSP00000137687
Gene: ENSMUSG00000034354

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	126	527	2.2e-148	PFAM
low complexity region	578	590	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
coiled coil region	1027	1058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155566

Meta Mutation Damage Score

0.4911

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased serum alkaline phosphatase level and, in males, impaired glucose tolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	A	6: 48,933,478	F701L	probably damaging	Het
4931409K22Rik	A	T	5: 24,544,166	L778Q	probably benign	Het
Adgrg6	T	A	10: 14,426,777	Y964F	probably damaging	Het
Akap3	T	A	6: 126,865,558	L380Q	probably damaging	Het
Alpk1	A	G	3: 127,680,074	I760T	probably benign	Het
Arhgap20	G	A	9: 51,824,976		probably benign	Het
Cacng3	T	C	7: 122,762,309	F113S	possibly damaging	Het
Ccdc158	G	T	5: 92,627,480	N955K	probably benign	Het
Ccdc63	T	A	5: 122,116,845	M368L	possibly damaging	Het
Cnot2	T	C	10: 116,527,946	T18A	probably damaging	Het
Ctnna2	A	T	6: 76,973,837	D550E	possibly damaging	Het
Cyp2c37	C	T	19: 40,011,732	R433W	probably damaging	Het
Dact2	A	G	17: 14,199,188	S103P	probably damaging	Het
Dek	A	G	13: 47,101,601		probably benign	Het
Dnah9	CAGTTGCTTAAA	CA	11: 66,095,240		probably null	Het
Dock4	A	G	12: 40,621,251	Y23C	probably damaging	Het
Edar	T	A	10: 58,603,179	S344C	probably damaging	Het
Epg5	T	C	18: 78,030,055	V2431A	probably benign	Het
Evc2	C	T	5: 37,404,724		probably benign	Het
Idh3b	A	T	2: 130,284,028	D41E	probably benign	Het
Igkv8-24	A	T	6: 70,216,972	V84D	probably damaging	Het
Mgam	T	C	6: 40,684,055	I1118T	probably benign	Het
Myoc	A	G	1: 162,639,367	Y35C	probably damaging	Het
Ncr1	A	T	7: 4,344,574	D246V	probably benign	Het
Nphp3	A	G	9: 104,003,037	E86G	probably damaging	Het
Olfr1097	A	C	2: 86,890,332	V281G	probably damaging	Het
Olfr168	A	T	16: 19,530,326	V198E	probably damaging	Het
Olfr678	A	T	7: 105,069,857	Y130F	probably benign	Het
Pbld1	A	T	10: 63,076,414	I275L	probably benign	Het
Pde12	A	G	14: 26,665,631	V574A	possibly damaging	Het
Pdxk	G	T	10: 78,445,038	D189E	probably benign	Het
Pkhd1	C	A	1: 20,374,736	E2276*	probably null	Het
Ppp1r10	A	G	17: 35,926,847	N237S	possibly damaging	Het
Rheb	T	A	5: 24,807,069	Y131F	probably benign	Het
Rpgrip1l	T	C	8: 91,304,985	D88G	probably damaging	Het
Scgb2b33	T	C	7: 33,112,814		noncoding transcript	Het
Snx9	C	A	17: 5,924,621	N461K	possibly damaging	Het
Tbc1d2b	C	A	9: 90,209,724	V842F	probably damaging	Het
Tgfbi	G	A	13: 56,636,605	E615K	possibly damaging	Het
Tmem51	A	G	4: 142,032,035	M134T	probably damaging	Het
Tox4	A	G	14: 52,286,784	D125G	probably damaging	Het
Trappc3	A	T	4: 126,273,978	N110I	probably damaging	Het
Trim11	T	A	11: 58,990,593	D437E	probably damaging	Het
Ttc23l	T	C	15: 10,537,596	N196S	probably benign	Het
Wnk1	C	A	6: 119,992,408	G362V	probably damaging	Het
Wwc1	A	G	11: 35,867,326	F731S	probably damaging	Het
Wwp1	A	T	4: 19,662,174	D140E	possibly damaging	Het
Zfp24	G	A	18: 24,018,038	P17L	possibly damaging	Het
Zfp354b	T	C	11: 50,923,216	E294G	probably damaging	Het
Zfp853	C	T	5: 143,288,669	V399M	unknown	Het
Zfp868	T	C	8: 69,611,652	H344R	probably damaging	Het

Other mutations in Mtmr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01568:Mtmr3	APN	11	4527861	missense	probably damaging	1.00
IGL01808:Mtmr3	APN	11	4497404	missense	probably damaging	1.00
IGL01994:Mtmr3	APN	11	4487938	missense	probably benign
IGL02839:Mtmr3	APN	11	4487994	missense	probably benign	0.03
IGL02893:Mtmr3	APN	11	4507632	missense	possibly damaging	0.89
IGL03370:Mtmr3	APN	11	4487385	missense	probably damaging	1.00
capellini	UTSW	11	4497381	nonsense	probably null
R0322:Mtmr3	UTSW	11	4487505	missense	possibly damaging	0.59
R0363:Mtmr3	UTSW	11	4487536	missense	probably damaging	0.99
R0655:Mtmr3	UTSW	11	4488610	missense	probably damaging	1.00
R0866:Mtmr3	UTSW	11	4488474	missense	probably benign	0.03
R1065:Mtmr3	UTSW	11	4492859	missense	probably damaging	1.00
R1417:Mtmr3	UTSW	11	4487923	missense	probably benign
R1698:Mtmr3	UTSW	11	4492825	missense	possibly damaging	0.95
R1707:Mtmr3	UTSW	11	4504095	missense	probably damaging	1.00
R2191:Mtmr3	UTSW	11	4499032	missense	probably damaging	1.00
R2192:Mtmr3	UTSW	11	4499032	missense	probably damaging	1.00
R3956:Mtmr3	UTSW	11	4491138	missense	probably damaging	1.00
R4079:Mtmr3	UTSW	11	4491057	missense	probably damaging	1.00
R4320:Mtmr3	UTSW	11	4487947	missense	probably benign	0.39
R4577:Mtmr3	UTSW	11	4497375	missense	probably damaging	1.00
R4622:Mtmr3	UTSW	11	4491067	missense	possibly damaging	0.62
R4676:Mtmr3	UTSW	11	4527855	missense	probably benign	0.12
R4726:Mtmr3	UTSW	11	4507634	missense	probably damaging	1.00
R4781:Mtmr3	UTSW	11	4488435	missense	probably benign	0.00
R4799:Mtmr3	UTSW	11	4487764	missense	probably benign	0.12
R4810:Mtmr3	UTSW	11	4498046	missense	probably benign	0.33
R5744:Mtmr3	UTSW	11	4487679	missense	possibly damaging	0.47
R5933:Mtmr3	UTSW	11	4498951	missense	probably benign
R6102:Mtmr3	UTSW	11	4487673	missense	probably damaging	0.99
R6105:Mtmr3	UTSW	11	4485432	missense	probably damaging	0.99
R6254:Mtmr3	UTSW	11	4497381	nonsense	probably null
R6443:Mtmr3	UTSW	11	4487358	missense	probably damaging	0.99
R6881:Mtmr3	UTSW	11	4489725	missense	probably benign	0.33
R6941:Mtmr3	UTSW	11	4487505	missense	possibly damaging	0.59
R6986:Mtmr3	UTSW	11	4489692	missense	probably damaging	1.00
R7045:Mtmr3	UTSW	11	4498896	missense	possibly damaging	0.94
R8469:Mtmr3	UTSW	11	4531223	start codon destroyed	probably null	0.95
T0975:Mtmr3	UTSW	11	4488441	missense	probably benign
Z1176:Mtmr3	UTSW	11	4485913	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAAAGGAACAGCAGCATGGCC -3'
(R):5'- GCCACATGTCATCCTTGGTG -3'

Sequencing Primer
(F):5'- AGCAGCATGGCCTCTGC -3'
(R):5'- ATGACTGCACTGGGTAGACTTATC -3'

Posted On

2017-02-10