Incidental Mutation 'R5847:Dock4'
ID453691
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Namededicator of cytokinesis 4
SynonymsEST N28122, 6330411N01Rik
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location40445952-40846874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40621251 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 23 (Y23C)
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037488
AA Change: Y23C

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: Y23C

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220912
AA Change: Y23C

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222860
Meta Mutation Damage Score 0.1537 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40832306 missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40790068 splice site probably benign
IGL00790:Dock4 APN 12 40834391 missense probably damaging 1.00
IGL01061:Dock4 APN 12 40702969 missense probably benign 0.01
IGL01083:Dock4 APN 12 40788381 splice site probably benign
IGL01412:Dock4 APN 12 40730041 splice site probably benign
IGL01583:Dock4 APN 12 40810467 nonsense probably null
IGL01603:Dock4 APN 12 40693031 missense probably damaging 1.00
IGL01766:Dock4 APN 12 40446379 nonsense probably null
IGL02067:Dock4 APN 12 40834385 missense probably damaging 1.00
IGL02302:Dock4 APN 12 40725777 missense probably damaging 1.00
IGL02406:Dock4 APN 12 40777207 missense probably benign 0.01
IGL02547:Dock4 APN 12 40737479 missense probably benign
IGL02613:Dock4 APN 12 40810466 missense probably damaging 1.00
IGL02643:Dock4 APN 12 40668430 missense probably damaging 1.00
IGL02952:Dock4 APN 12 40710903 critical splice donor site probably null
IGL02994:Dock4 APN 12 40779160 missense probably damaging 0.99
IGL03096:Dock4 APN 12 40748001 missense probably benign 0.00
IGL03144:Dock4 APN 12 40692907 splice site probably benign
IGL03223:Dock4 APN 12 40817594 missense probably damaging 1.00
IGL03296:Dock4 APN 12 40733257 missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40733310 missense probably benign 0.42
IGL03353:Dock4 APN 12 40817758 splice site probably null
BB005:Dock4 UTSW 12 40788303 missense probably damaging 0.98
BB015:Dock4 UTSW 12 40788303 missense probably damaging 0.98
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0110:Dock4 UTSW 12 40621312 splice site probably benign
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0472:Dock4 UTSW 12 40838438 intron probably benign
R0616:Dock4 UTSW 12 40704415 missense probably benign 0.31
R0647:Dock4 UTSW 12 40710884 missense probably damaging 1.00
R0706:Dock4 UTSW 12 40702923 missense probably damaging 0.98
R0791:Dock4 UTSW 12 40704481 missense probably damaging 1.00
R0940:Dock4 UTSW 12 40631627 splice site probably benign
R1087:Dock4 UTSW 12 40729938 missense probably benign 0.40
R1180:Dock4 UTSW 12 40640414 missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40829616 missense probably damaging 1.00
R1463:Dock4 UTSW 12 40816325 frame shift probably null
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1523:Dock4 UTSW 12 40693025 missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40669045 missense probably damaging 0.99
R1682:Dock4 UTSW 12 40725780 missense probably damaging 1.00
R1691:Dock4 UTSW 12 40725755 missense probably benign 0.26
R1693:Dock4 UTSW 12 40834722 missense probably benign 0.07
R1737:Dock4 UTSW 12 40807001 splice site probably null
R1802:Dock4 UTSW 12 40794598 missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40636228 missense probably damaging 1.00
R1846:Dock4 UTSW 12 40733268 missense probably benign 0.00
R1959:Dock4 UTSW 12 40710798 missense probably damaging 1.00
R1975:Dock4 UTSW 12 40779642 splice site probably benign
R1986:Dock4 UTSW 12 40730063 missense probably damaging 1.00
R2105:Dock4 UTSW 12 40692989 missense probably benign 0.00
R2134:Dock4 UTSW 12 40745668 missense probably benign
R2135:Dock4 UTSW 12 40745668 missense probably benign
R2154:Dock4 UTSW 12 40820662 missense probably damaging 1.00
R2154:Dock4 UTSW 12 40844548 small insertion probably benign
R2864:Dock4 UTSW 12 40730073 missense probably damaging 1.00
R2890:Dock4 UTSW 12 40623801 critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40731863 missense probably benign 0.02
R3808:Dock4 UTSW 12 40672810 missense probably damaging 0.99
R3811:Dock4 UTSW 12 40779124 missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40794624 critical splice donor site probably null
R3838:Dock4 UTSW 12 40794624 critical splice donor site probably null
R4091:Dock4 UTSW 12 40844267 missense probably damaging 0.99
R4735:Dock4 UTSW 12 40631526 missense probably benign 0.31
R4752:Dock4 UTSW 12 40446365 missense probably benign 0.04
R4828:Dock4 UTSW 12 40668437 missense probably damaging 1.00
R5039:Dock4 UTSW 12 40817746 missense probably damaging 1.00
R5092:Dock4 UTSW 12 40844441 missense probably benign
R5146:Dock4 UTSW 12 40649492 splice site probably null
R5213:Dock4 UTSW 12 40676742 missense probably damaging 1.00
R5214:Dock4 UTSW 12 40704466 missense probably benign 0.00
R5270:Dock4 UTSW 12 40733271 missense probably benign 0.02
R5426:Dock4 UTSW 12 40745745 missense probably damaging 1.00
R5474:Dock4 UTSW 12 40745731 missense probably benign
R5544:Dock4 UTSW 12 40834702 missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40649480 missense probably benign 0.22
R5649:Dock4 UTSW 12 40844540 missense probably benign 0.03
R5702:Dock4 UTSW 12 40737491 missense probably benign 0.02
R5846:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R5895:Dock4 UTSW 12 40755813 missense probably damaging 1.00
R5997:Dock4 UTSW 12 40755834 missense probably damaging 0.99
R6011:Dock4 UTSW 12 40817757 critical splice donor site probably null
R6022:Dock4 UTSW 12 40748110 missense probably benign 0.04
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6179:Dock4 UTSW 12 40731869 missense probably benign 0.00
R6479:Dock4 UTSW 12 40828955 missense probably damaging 1.00
R6516:Dock4 UTSW 12 40731899 missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40704466 missense probably benign 0.44
R6752:Dock4 UTSW 12 40820617 missense probably damaging 1.00
R6814:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6864:Dock4 UTSW 12 40745746 missense probably damaging 1.00
R6872:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6891:Dock4 UTSW 12 40779136 missense probably damaging 1.00
R6937:Dock4 UTSW 12 40834635 missense probably benign 0.01
R6950:Dock4 UTSW 12 40733314 missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40621286 missense probably damaging 1.00
R7129:Dock4 UTSW 12 40828879 missense probably damaging 1.00
R7140:Dock4 UTSW 12 40636159 missense probably benign 0.06
R7241:Dock4 UTSW 12 40794860 missense probably damaging 1.00
R7378:Dock4 UTSW 12 40788244 missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40725649 nonsense probably null
R7720:Dock4 UTSW 12 40806975 missense probably damaging 0.99
R7756:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7758:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7759:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R7787:Dock4 UTSW 12 40725677 missense probably benign
R7879:Dock4 UTSW 12 40730084 missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40788303 missense probably damaging 0.98
R8000:Dock4 UTSW 12 40833119 missense probably benign 0.05
R8042:Dock4 UTSW 12 40745760 missense probably benign 0.01
R8231:Dock4 UTSW 12 40702951 missense possibly damaging 0.88
RF018:Dock4 UTSW 12 40844399 frame shift probably null
RF025:Dock4 UTSW 12 40844393 frame shift probably null
RF063:Dock4 UTSW 12 40844399 frame shift probably null
X0028:Dock4 UTSW 12 40669047 missense probably benign 0.25
Z1176:Dock4 UTSW 12 40631614 missense probably benign 0.01
Z1176:Dock4 UTSW 12 40631616 missense probably benign 0.16
Z1177:Dock4 UTSW 12 40817641 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACATACTACCTGGGGTGTATTCC -3'
(R):5'- CTCCATCTCCACGTAAGGAC -3'

Sequencing Primer
(F):5'- ACCTGGGGTGTATTCCTTATATTTTC -3'
(R):5'- TCTCCACGTAAGGACTAAAAGATG -3'
Posted On2017-02-10