Incidental Mutation 'R5847:Dek'
ID453692
Institutional Source Beutler Lab
Gene Symbol Dek
Ensembl Gene ENSMUSG00000021377
Gene NameDEK oncogene (DNA binding)
SynonymsD13H6S231E, 1810019E15Rik
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location47084775-47106201 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 47101601 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021807] [ENSMUST00000129352] [ENSMUST00000135278] [ENSMUST00000224150]
Predicted Effect probably benign
Transcript: ENSMUST00000021807
SMART Domains Protein: ENSMUSP00000021807
Gene: ENSMUSG00000021377

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
low complexity region 190 210 N/A INTRINSIC
low complexity region 231 315 N/A INTRINSIC
Pfam:DEK_C 327 379 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129352
SMART Domains Protein: ENSMUSP00000114392
Gene: ENSMUSG00000021377

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
low complexity region 190 210 N/A INTRINSIC
low complexity region 231 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135278
SMART Domains Protein: ENSMUSP00000121663
Gene: ENSMUSG00000021377

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150652
Predicted Effect probably benign
Transcript: ENSMUST00000224150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224610
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed development of DMBA- and TPA-induced papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Dek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Dek APN 13 47088135 missense probably benign 0.37
R1438:Dek UTSW 13 47088171 missense probably benign 0.23
R4118:Dek UTSW 13 47088600 missense probably benign 0.01
R5235:Dek UTSW 13 47086479 unclassified probably null
R6285:Dek UTSW 13 47099380 missense probably damaging 1.00
R6736:Dek UTSW 13 47099390 missense probably damaging 1.00
R6903:Dek UTSW 13 47098187 missense possibly damaging 0.83
R7120:Dek UTSW 13 47100183 missense unknown
R7359:Dek UTSW 13 47105589 missense unknown
R7372:Dek UTSW 13 47105577 missense unknown
R7504:Dek UTSW 13 47088035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTAGACCCAGTTAGGAGG -3'
(R):5'- CCCTGTTAGCACAAAGTTATCC -3'

Sequencing Primer
(F):5'- CCAGCTATGTTTACCATGGTATG -3'
(R):5'- AAAGTTATCCAAATTATGTGGTGGGG -3'
Posted On2017-02-10