Incidental Mutation 'R5847:Tgfbi'
ID453693
Institutional Source Beutler Lab
Gene Symbol Tgfbi
Ensembl Gene ENSMUSG00000035493
Gene Nametransforming growth factor, beta induced
Synonyms68kDa, bIG-h3, Beta-ig
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56609523-56639562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56636605 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 615 (E615K)
Ref Sequence ENSEMBL: ENSMUSP00000153546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045173] [ENSMUST00000225600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045173
AA Change: E615K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037719
Gene: ENSMUSG00000035493
AA Change: E615K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 139 239 1.35e-33 SMART
FAS1 276 374 6.75e-34 SMART
FAS1 411 501 1.16e-14 SMART
FAS1 538 635 6.75e-34 SMART
low complexity region 656 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225300
Predicted Effect possibly damaging
Transcript: ENSMUST00000225600
AA Change: E615K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226024
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show delayed growth and are prone to spontaneous and induced tumors. Homozygotes for a second null allele are prone to STZ-induced diabetes and show impaired islet function under stress. Homozygotes for a third null allele show a transient decrease in retinal apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Tgfbi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Tgfbi APN 13 56630595 missense probably benign 0.41
IGL02021:Tgfbi APN 13 56631353 missense probably damaging 1.00
IGL02325:Tgfbi APN 13 56631230 missense probably benign 0.00
PIT4486001:Tgfbi UTSW 13 56629794 missense probably damaging 0.98
R0008:Tgfbi UTSW 13 56629774 missense probably benign 0.00
R0122:Tgfbi UTSW 13 56627968 missense probably damaging 1.00
R0389:Tgfbi UTSW 13 56629702 missense probably benign 0.02
R0419:Tgfbi UTSW 13 56632193 splice site probably benign
R0432:Tgfbi UTSW 13 56632191 splice site probably benign
R0671:Tgfbi UTSW 13 56638726 missense probably null 1.00
R0825:Tgfbi UTSW 13 56638710 splice site probably benign
R1263:Tgfbi UTSW 13 56630655 missense probably damaging 1.00
R1597:Tgfbi UTSW 13 56632191 splice site probably benign
R1864:Tgfbi UTSW 13 56632881 missense probably benign 0.16
R1940:Tgfbi UTSW 13 56614314 missense possibly damaging 0.92
R2570:Tgfbi UTSW 13 56638708 splice site probably null
R3111:Tgfbi UTSW 13 56609734 missense probably damaging 1.00
R3613:Tgfbi UTSW 13 56625726 missense probably damaging 1.00
R4815:Tgfbi UTSW 13 56632120 missense probably benign 0.45
R6314:Tgfbi UTSW 13 56626163 missense probably benign 0.01
R6810:Tgfbi UTSW 13 56637203 missense probably benign
R6821:Tgfbi UTSW 13 56626137 missense possibly damaging 0.95
R6943:Tgfbi UTSW 13 56637176 missense possibly damaging 0.77
R7165:Tgfbi UTSW 13 56628016 missense probably damaging 0.99
R7297:Tgfbi UTSW 13 56632113 missense possibly damaging 0.74
R7770:Tgfbi UTSW 13 56632844 splice site probably null
R7910:Tgfbi UTSW 13 56632184 missense probably damaging 1.00
R7914:Tgfbi UTSW 13 56629689 missense probably damaging 1.00
R8721:Tgfbi UTSW 13 56625786 missense probably benign 0.08
R8758:Tgfbi UTSW 13 56632081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACATAAGGCAGGAGAAGTCTG -3'
(R):5'- TGCCTCAAGTTCTGTAGCATG -3'

Sequencing Primer
(F):5'- CAGGAGAAGTCTGCAGAGGGC -3'
(R):5'- CTTAAAACCACAGTCCTGGGTTGG -3'
Posted On2017-02-10