Incidental Mutation 'R5847:Ppp1r10'
ID453700
Institutional Source Beutler Lab
Gene Symbol Ppp1r10
Ensembl Gene ENSMUSG00000039220
Gene Nameprotein phosphatase 1, regulatory subunit 10
SynonymsPNUTS, D17Ertd808e, 2610025H06Rik
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35916434-35932283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35926847 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 237 (N237S)
Ref Sequence ENSEMBL: ENSMUSP00000084461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087210] [ENSMUST00000087211] [ENSMUST00000151664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087210
AA Change: N237S

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084460
Gene: ENSMUSG00000039220
AA Change: N237S

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087211
AA Change: N237S

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084461
Gene: ENSMUSG00000039220
AA Change: N237S

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151375
Predicted Effect probably benign
Transcript: ENSMUST00000151664
Meta Mutation Damage Score 0.0709 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase 1 binding protein. The encoded protein plays a role in many cellular processes including cell cycle progression, DNA repair and apoptosis by regulating the activity of protein phosphatase 1. This gene lies within the major histocompatibility complex class I region on chromosome 6, and alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Ppp1r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp1r10 APN 17 35924859 missense probably damaging 0.99
IGL01113:Ppp1r10 APN 17 35929559 missense probably damaging 0.98
IGL01144:Ppp1r10 APN 17 35926564 missense probably benign 0.28
IGL01650:Ppp1r10 APN 17 35931161 missense unknown
IGL02445:Ppp1r10 APN 17 35926202 missense probably damaging 1.00
IGL02715:Ppp1r10 APN 17 35930712 missense unknown
IGL02797:Ppp1r10 APN 17 35928012 critical splice donor site probably null
IGL03181:Ppp1r10 APN 17 35930624 nonsense probably null
R1183:Ppp1r10 UTSW 17 35929443 missense possibly damaging 0.56
R1710:Ppp1r10 UTSW 17 35926536 missense probably damaging 0.96
R2166:Ppp1r10 UTSW 17 35930589 missense unknown
R2865:Ppp1r10 UTSW 17 35928492 missense possibly damaging 0.86
R2898:Ppp1r10 UTSW 17 35928892 missense probably damaging 1.00
R3692:Ppp1r10 UTSW 17 35930868 missense unknown
R4612:Ppp1r10 UTSW 17 35927931 missense probably damaging 1.00
R4716:Ppp1r10 UTSW 17 35929460 missense probably benign 0.16
R4796:Ppp1r10 UTSW 17 35924087 missense probably damaging 1.00
R4997:Ppp1r10 UTSW 17 35924084 missense probably damaging 1.00
R5152:Ppp1r10 UTSW 17 35929252 missense probably damaging 1.00
R5186:Ppp1r10 UTSW 17 35928511 missense probably damaging 1.00
R5364:Ppp1r10 UTSW 17 35930432 missense unknown
R5705:Ppp1r10 UTSW 17 35929489 missense probably damaging 1.00
R6912:Ppp1r10 UTSW 17 35929561 missense possibly damaging 0.70
R6974:Ppp1r10 UTSW 17 35929551 missense probably benign 0.03
R7169:Ppp1r10 UTSW 17 35929473 missense probably damaging 1.00
R7302:Ppp1r10 UTSW 17 35930881 missense unknown
R7403:Ppp1r10 UTSW 17 35929434 missense probably benign 0.05
R7427:Ppp1r10 UTSW 17 35930133 missense possibly damaging 0.53
R8006:Ppp1r10 UTSW 17 35928266 missense probably benign 0.00
R8850:Ppp1r10 UTSW 17 35928798 missense probably damaging 0.97
Z1088:Ppp1r10 UTSW 17 35930767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GGACCATCACATGCACAGTC -3'
(R):5'- AGAGGCTTGTATTTCTTCTCTGCAG -3'

Sequencing Primer
(F):5'- GATTGCAGTGTCAAACTCTAGG -3'
(R):5'- CTTCTCTGCAGGTGGGGC -3'
Posted On2017-02-10