Incidental Mutation 'R5847:Cyp2c37'
ID453703
Institutional Source Beutler Lab
Gene Symbol Cyp2c37
Ensembl Gene ENSMUSG00000042248
Gene Namecytochrome P450, family 2. subfamily c, polypeptide 37
Synonyms
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39992424-40012243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40011732 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 433 (R433W)
Ref Sequence ENSEMBL: ENSMUSP00000045362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049178]
Predicted Effect probably damaging
Transcript: ENSMUST00000049178
AA Change: R433W

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045362
Gene: ENSMUSG00000042248
AA Change: R433W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 5e-160 PFAM
Meta Mutation Damage Score 0.506 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Cyp2c37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Cyp2c37 APN 19 40001997 missense probably benign 0.00
IGL01307:Cyp2c37 APN 19 39992579 missense probably benign 0.00
IGL01959:Cyp2c37 APN 19 39995833 nonsense probably null
IGL02580:Cyp2c37 APN 19 39994498 missense probably damaging 1.00
IGL02611:Cyp2c37 APN 19 39993865 missense probably benign 0.00
R0124:Cyp2c37 UTSW 19 39994102 missense probably damaging 1.00
R0391:Cyp2c37 UTSW 19 39994506 missense probably damaging 1.00
R0420:Cyp2c37 UTSW 19 39995794 missense probably benign 0.00
R0782:Cyp2c37 UTSW 19 39993825 missense probably benign 0.00
R1413:Cyp2c37 UTSW 19 39994098 missense probably benign 0.21
R1637:Cyp2c37 UTSW 19 40001982 nonsense probably null
R1688:Cyp2c37 UTSW 19 39994443 splice site probably null
R2258:Cyp2c37 UTSW 19 39995859 missense possibly damaging 0.49
R4353:Cyp2c37 UTSW 19 40000545 missense possibly damaging 0.66
R4640:Cyp2c37 UTSW 19 40011832 missense possibly damaging 0.67
R4965:Cyp2c37 UTSW 19 40011762 missense possibly damaging 0.79
R5053:Cyp2c37 UTSW 19 40001887 missense probably benign 0.00
R5645:Cyp2c37 UTSW 19 39994152 missense probably benign 0.04
R6487:Cyp2c37 UTSW 19 39994581 missense probably benign
R6631:Cyp2c37 UTSW 19 40009843 missense probably damaging 1.00
R7062:Cyp2c37 UTSW 19 39995546 intron probably null
Predicted Primers PCR Primer
(F):5'- TGTCAACTTGCCTAATAGGGTATC -3'
(R):5'- AAGCCTCAGGGTGATCACAG -3'

Sequencing Primer
(F):5'- AATAGGGTATCTTCTCAGCCATTCG -3'
(R):5'- TGATCACAGAAGATGTCCCAGCTG -3'
Posted On2017-02-10