Incidental Mutation 'R5848:4930553M12Rik'
ID453708
Institutional Source Beutler Lab
Gene Symbol 4930553M12Rik
Ensembl Gene ENSMUSG00000054351
Gene NameRIKEN cDNA 4930553M12 gene
Synonyms
MMRRC Submission 043225-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5848 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88867882-88868379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88868359 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 7 (I7M)
Ref Sequence ENSEMBL: ENSMUSP00000052657 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000057837
AA Change: I7M
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik T C 4: 116,173,615 I72T probably damaging Het
Aadacl4 T A 4: 144,617,858 M68K probably benign Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Armc4 T A 18: 7,268,507 probably null Het
Cdcp1 T A 9: 123,183,705 H259L possibly damaging Het
Ckap4 T C 10: 84,533,490 Q126R probably benign Het
Clec18a C T 8: 111,075,461 V299I probably benign Het
D7Ertd443e A G 7: 134,349,722 I27T possibly damaging Het
Dlg2 T G 7: 92,444,527 D726E probably benign Het
Dnah8 T C 17: 30,728,191 I1856T possibly damaging Het
Espl1 G A 15: 102,322,576 V1837I probably benign Het
Fanca G T 8: 123,295,053 probably benign Het
Fer1l5 A G 1: 36,388,935 T437A probably benign Het
Gm10644 C A 8: 83,934,039 probably benign Het
Katnb1 A G 8: 95,098,712 S635G probably benign Het
Map3k12 A G 15: 102,504,235 V234A possibly damaging Het
Mks1 A G 11: 87,856,870 N193S probably benign Het
Mmp11 T C 10: 75,927,389 E151G probably damaging Het
Napg A G 18: 62,994,369 R265G possibly damaging Het
Olfr49 A G 14: 54,282,565 F110S possibly damaging Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Pcdha7 G T 18: 36,975,083 C387F probably damaging Het
Pcdhb3 G T 18: 37,301,647 R222L probably benign Het
Phf2 A G 13: 48,820,070 M373T unknown Het
Plekha7 T C 7: 116,140,399 T636A probably damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf6 G A 5: 146,211,149 P353L probably benign Het
Sel1l3 A C 5: 53,184,808 L357V possibly damaging Het
Sh3rf3 T A 10: 58,984,153 M262K possibly damaging Het
Sorcs3 A T 19: 48,788,511 H994L probably damaging Het
Thsd7a A T 6: 12,503,923 C411S probably damaging Het
Ttn T C 2: 76,763,338 K20653E probably damaging Het
Ttn A G 2: 76,780,920 W15677R probably damaging Het
Ttn A C 2: 76,878,564 probably null Het
Ubr2 T C 17: 46,956,655 M1049V possibly damaging Het
Other mutations in 4930553M12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:4930553M12Rik APN 4 88868073 nonsense probably null
R0194:4930553M12Rik UTSW 4 88868243 missense unknown
R2143:4930553M12Rik UTSW 4 88868174 missense unknown
R2143:4930553M12Rik UTSW 4 88868175 missense unknown
R2144:4930553M12Rik UTSW 4 88868174 missense unknown
R2144:4930553M12Rik UTSW 4 88868175 missense unknown
R5135:4930553M12Rik UTSW 4 88868271 missense unknown
R5822:4930553M12Rik UTSW 4 88868359 missense unknown
R5849:4930553M12Rik UTSW 4 88868359 missense unknown
R5850:4930553M12Rik UTSW 4 88868359 missense unknown
R5854:4930553M12Rik UTSW 4 88868359 missense unknown
R5856:4930553M12Rik UTSW 4 88868359 missense unknown
R6128:4930553M12Rik UTSW 4 88868359 missense unknown
R6130:4930553M12Rik UTSW 4 88868359 missense unknown
R7054:4930553M12Rik UTSW 4 88868249 missense unknown
R7292:4930553M12Rik UTSW 4 88868331 missense unknown
R7754:4930553M12Rik UTSW 4 88868259 missense unknown
R7844:4930553M12Rik UTSW 4 88868186 missense unknown
R7980:4930553M12Rik UTSW 4 88868078 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCTTTCTCGCCCAAAGAATC -3'
(R):5'- AAAGAATATTCTGGCACTGGGTC -3'

Sequencing Primer
(F):5'- AAAGAATCCGCTTATTCCCCTG -3'
(R):5'- CCTTTTGGAGCCAGCCAAC -3'
Posted On2017-02-10