Incidental Mutation 'R5848:Aadacl4'
ID453710
Institutional Source Beutler Lab
Gene Symbol Aadacl4
Ensembl Gene ENSMUSG00000070609
Gene Namearylacetamide deacetylase like 4
SynonymsGm13177
MMRRC Submission 043225-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5848 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144613707-144623398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144617858 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 68 (M68K)
Ref Sequence ENSEMBL: ENSMUSP00000092087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094510]
Predicted Effect probably benign
Transcript: ENSMUST00000094510
AA Change: M68K

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092087
Gene: ENSMUSG00000070609
AA Change: M68K

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
transmembrane domain 43 60 N/A INTRINSIC
Pfam:Abhydrolase_3 115 285 9.6e-30 PFAM
Pfam:Abhydrolase_3 272 381 4.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik T C 4: 116,173,615 I72T probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Armc4 T A 18: 7,268,507 probably null Het
Cdcp1 T A 9: 123,183,705 H259L possibly damaging Het
Ckap4 T C 10: 84,533,490 Q126R probably benign Het
Clec18a C T 8: 111,075,461 V299I probably benign Het
D7Ertd443e A G 7: 134,349,722 I27T possibly damaging Het
Dlg2 T G 7: 92,444,527 D726E probably benign Het
Dnah8 T C 17: 30,728,191 I1856T possibly damaging Het
Espl1 G A 15: 102,322,576 V1837I probably benign Het
Fanca G T 8: 123,295,053 probably benign Het
Fer1l5 A G 1: 36,388,935 T437A probably benign Het
Gm10644 C A 8: 83,934,039 probably benign Het
Katnb1 A G 8: 95,098,712 S635G probably benign Het
Map3k12 A G 15: 102,504,235 V234A possibly damaging Het
Mks1 A G 11: 87,856,870 N193S probably benign Het
Mmp11 T C 10: 75,927,389 E151G probably damaging Het
Napg A G 18: 62,994,369 R265G possibly damaging Het
Olfr49 A G 14: 54,282,565 F110S possibly damaging Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Pcdha7 G T 18: 36,975,083 C387F probably damaging Het
Pcdhb3 G T 18: 37,301,647 R222L probably benign Het
Phf2 A G 13: 48,820,070 M373T unknown Het
Plekha7 T C 7: 116,140,399 T636A probably damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf6 G A 5: 146,211,149 P353L probably benign Het
Sel1l3 A C 5: 53,184,808 L357V possibly damaging Het
Sh3rf3 T A 10: 58,984,153 M262K possibly damaging Het
Sorcs3 A T 19: 48,788,511 H994L probably damaging Het
Thsd7a A T 6: 12,503,923 C411S probably damaging Het
Ttn T C 2: 76,763,338 K20653E probably damaging Het
Ttn A G 2: 76,780,920 W15677R probably damaging Het
Ttn A C 2: 76,878,564 probably null Het
Ubr2 T C 17: 46,956,655 M1049V possibly damaging Het
Other mutations in Aadacl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Aadacl4 APN 4 144617822 critical splice acceptor site probably null
IGL02836:Aadacl4 APN 4 144623212 missense possibly damaging 0.79
IGL02949:Aadacl4 APN 4 144617920 missense probably damaging 1.00
IGL03253:Aadacl4 APN 4 144623288 missense probably benign 0.05
white_rabbit UTSW 4 144618028 missense probably benign 0.03
R0035:Aadacl4 UTSW 4 144617941 missense probably damaging 0.98
R0268:Aadacl4 UTSW 4 144622995 missense probably benign 0.00
R1427:Aadacl4 UTSW 4 144623040 missense probably damaging 1.00
R1672:Aadacl4 UTSW 4 144623319 nonsense probably null
R2220:Aadacl4 UTSW 4 144618002 missense probably damaging 0.98
R2353:Aadacl4 UTSW 4 144623209 missense probably damaging 1.00
R2983:Aadacl4 UTSW 4 144623214 missense probably damaging 0.98
R4708:Aadacl4 UTSW 4 144623329 missense probably benign 0.01
R4878:Aadacl4 UTSW 4 144613845 missense possibly damaging 0.62
R4911:Aadacl4 UTSW 4 144613792 missense probably damaging 1.00
R5208:Aadacl4 UTSW 4 144617828 missense probably benign 0.04
R5237:Aadacl4 UTSW 4 144623280 nonsense probably null
R5568:Aadacl4 UTSW 4 144622794 missense probably benign 0.03
R5633:Aadacl4 UTSW 4 144618028 missense probably benign 0.03
R5817:Aadacl4 UTSW 4 144622927 missense probably benign 0.04
R5916:Aadacl4 UTSW 4 144622980 missense possibly damaging 0.93
R6736:Aadacl4 UTSW 4 144623339 missense possibly damaging 0.82
R6814:Aadacl4 UTSW 4 144623180 missense probably benign 0.07
R6872:Aadacl4 UTSW 4 144623180 missense probably benign 0.07
R6971:Aadacl4 UTSW 4 144622733 missense probably damaging 1.00
R6994:Aadacl4 UTSW 4 144623279 missense probably damaging 1.00
R7074:Aadacl4 UTSW 4 144613863 missense probably benign
R7353:Aadacl4 UTSW 4 144617920 missense probably damaging 1.00
X0017:Aadacl4 UTSW 4 144623016 missense probably damaging 1.00
X0065:Aadacl4 UTSW 4 144623109 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGGCTGCAGCATCTACAAG -3'
(R):5'- AAAGTACTCACCCAGGCTGC -3'

Sequencing Primer
(F):5'- GCATCTACAAGCCTACCTTATAGTC -3'
(R):5'- CCCAGGCTGCCACATATG -3'
Posted On2017-02-10