Incidental Mutation 'R5848:Plekha7'
ID453716
Institutional Source Beutler Lab
Gene Symbol Plekha7
Ensembl Gene ENSMUSG00000045659
Gene Namepleckstrin homology domain containing, family A member 7
SynonymsA430081P20Rik
MMRRC Submission 043225-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R5848 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location116123485-116308376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116140399 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 636 (T636A)
Ref Sequence ENSEMBL: ENSMUSP00000081714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084664] [ENSMUST00000181981] [ENSMUST00000181998] [ENSMUST00000182487] [ENSMUST00000182511] [ENSMUST00000182834] [ENSMUST00000183281] [ENSMUST00000216517]
Predicted Effect probably damaging
Transcript: ENSMUST00000084664
AA Change: T636A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081714
Gene: ENSMUSG00000045659
AA Change: T636A

DomainStartEndE-ValueType
Blast:PH 1 47 2e-23 BLAST
SCOP:d1kz7a2 18 69 1e-5 SMART
low complexity region 100 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 322 351 N/A INTRINSIC
coiled coil region 461 500 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
low complexity region 677 693 N/A INTRINSIC
coiled coil region 828 856 N/A INTRINSIC
low complexity region 947 959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181981
AA Change: T767A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138766
Gene: ENSMUSG00000045659
AA Change: T767A

DomainStartEndE-ValueType
PH 59 178 1.42e-18 SMART
low complexity region 231 243 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 453 482 N/A INTRINSIC
coiled coil region 592 631 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 808 824 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181998
AA Change: T872A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138575
Gene: ENSMUSG00000045659
AA Change: T872A

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
low complexity region 1183 1195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182443
AA Change: T790A
Predicted Effect probably benign
Transcript: ENSMUST00000182487
AA Change: T872A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138214
Gene: ENSMUSG00000045659
AA Change: T872A

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182511
AA Change: T810A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138544
Gene: ENSMUSG00000045659
AA Change: T810A

DomainStartEndE-ValueType
PH 102 221 1.42e-18 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 496 525 N/A INTRINSIC
coiled coil region 635 674 N/A INTRINSIC
coiled coil region 703 736 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
coiled coil region 1002 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182834
AA Change: T826A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138257
Gene: ENSMUSG00000045659
AA Change: T826A

DomainStartEndE-ValueType
PH 118 237 1.42e-18 SMART
low complexity region 290 302 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 512 541 N/A INTRINSIC
coiled coil region 651 690 N/A INTRINSIC
coiled coil region 719 752 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
coiled coil region 1018 1046 N/A INTRINSIC
low complexity region 1137 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183281
SMART Domains Protein: ENSMUSP00000138126
Gene: ENSMUSG00000045659

DomainStartEndE-ValueType
coiled coil region 117 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216517
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik T C 4: 116,173,615 I72T probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Aadacl4 T A 4: 144,617,858 M68K probably benign Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Armc4 T A 18: 7,268,507 probably null Het
Cdcp1 T A 9: 123,183,705 H259L possibly damaging Het
Ckap4 T C 10: 84,533,490 Q126R probably benign Het
Clec18a C T 8: 111,075,461 V299I probably benign Het
D7Ertd443e A G 7: 134,349,722 I27T possibly damaging Het
Dlg2 T G 7: 92,444,527 D726E probably benign Het
Dnah8 T C 17: 30,728,191 I1856T possibly damaging Het
Espl1 G A 15: 102,322,576 V1837I probably benign Het
Fanca G T 8: 123,295,053 probably benign Het
Fer1l5 A G 1: 36,388,935 T437A probably benign Het
Gm10644 C A 8: 83,934,039 probably benign Het
Katnb1 A G 8: 95,098,712 S635G probably benign Het
Map3k12 A G 15: 102,504,235 V234A possibly damaging Het
Mks1 A G 11: 87,856,870 N193S probably benign Het
Mmp11 T C 10: 75,927,389 E151G probably damaging Het
Napg A G 18: 62,994,369 R265G possibly damaging Het
Olfr49 A G 14: 54,282,565 F110S possibly damaging Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Pcdha7 G T 18: 36,975,083 C387F probably damaging Het
Pcdhb3 G T 18: 37,301,647 R222L probably benign Het
Phf2 A G 13: 48,820,070 M373T unknown Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf6 G A 5: 146,211,149 P353L probably benign Het
Sel1l3 A C 5: 53,184,808 L357V possibly damaging Het
Sh3rf3 T A 10: 58,984,153 M262K possibly damaging Het
Sorcs3 A T 19: 48,788,511 H994L probably damaging Het
Thsd7a A T 6: 12,503,923 C411S probably damaging Het
Ttn T C 2: 76,763,338 K20653E probably damaging Het
Ttn A G 2: 76,780,920 W15677R probably damaging Het
Ttn A C 2: 76,878,564 probably null Het
Ubr2 T C 17: 46,956,655 M1049V possibly damaging Het
Other mutations in Plekha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Plekha7 APN 7 116135184 missense probably damaging 1.00
IGL01133:Plekha7 APN 7 116145241 splice site probably null
IGL01146:Plekha7 APN 7 116157473 splice site probably benign
IGL01307:Plekha7 APN 7 116145244 splice site probably benign
IGL02063:Plekha7 APN 7 116140701 missense possibly damaging 0.78
IGL02110:Plekha7 APN 7 116154628 splice site probably null
IGL02420:Plekha7 APN 7 116158234 missense probably damaging 1.00
IGL02660:Plekha7 APN 7 116157574 splice site probably benign
IGL02851:Plekha7 APN 7 116135178 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0130:Plekha7 UTSW 7 116170704 missense probably damaging 0.99
R0348:Plekha7 UTSW 7 116158020 missense probably damaging 1.00
R0595:Plekha7 UTSW 7 116144968 missense probably damaging 1.00
R0614:Plekha7 UTSW 7 116154645 nonsense probably null
R0732:Plekha7 UTSW 7 116145237 missense probably damaging 1.00
R1664:Plekha7 UTSW 7 116135034 splice site probably null
R1695:Plekha7 UTSW 7 116128685 missense probably damaging 1.00
R1794:Plekha7 UTSW 7 116140681 missense probably damaging 1.00
R1895:Plekha7 UTSW 7 116144974 missense probably damaging 1.00
R2153:Plekha7 UTSW 7 116175767 missense probably damaging 1.00
R3106:Plekha7 UTSW 7 116164404 missense probably benign 0.02
R3605:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3606:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3789:Plekha7 UTSW 7 116175734 missense probably damaging 1.00
R4584:Plekha7 UTSW 7 116237533 intron probably benign
R4750:Plekha7 UTSW 7 116137311 missense probably damaging 1.00
R4774:Plekha7 UTSW 7 116144943 missense probably damaging 1.00
R4810:Plekha7 UTSW 7 116144938 missense probably damaging 1.00
R4895:Plekha7 UTSW 7 116189391 unclassified probably null
R4925:Plekha7 UTSW 7 116158128 missense probably damaging 1.00
R5556:Plekha7 UTSW 7 116164149 missense probably benign 0.20
R5599:Plekha7 UTSW 7 116176882 splice site probably null
R5928:Plekha7 UTSW 7 116128574 missense probably benign
R5941:Plekha7 UTSW 7 116124805 missense possibly damaging 0.56
R6351:Plekha7 UTSW 7 116176898 missense probably damaging 1.00
R6520:Plekha7 UTSW 7 116164482 missense probably benign 0.16
R6699:Plekha7 UTSW 7 116135175 missense probably damaging 1.00
R6781:Plekha7 UTSW 7 116157855 critical splice donor site probably null
R6843:Plekha7 UTSW 7 116143320 missense probably benign 0.45
R6977:Plekha7 UTSW 7 116135967 missense probably benign 0.01
R7048:Plekha7 UTSW 7 116148324 missense probably benign 0.07
R7269:Plekha7 UTSW 7 116181212 missense probably damaging 1.00
R7480:Plekha7 UTSW 7 116137168 intron probably null
R7520:Plekha7 UTSW 7 116137284 missense possibly damaging 0.95
R7609:Plekha7 UTSW 7 116164446 missense probably benign 0.25
R7680:Plekha7 UTSW 7 116164276 missense probably benign 0.00
R7820:Plekha7 UTSW 7 116237480 missense probably benign 0.12
Z1177:Plekha7 UTSW 7 116140663 missense probably benign 0.01
Z1177:Plekha7 UTSW 7 116307971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGCGATTCAGCCAGTG -3'
(R):5'- TCTTCCTGGCGTAGAACACAG -3'

Sequencing Primer
(F):5'- ACTCACTGGTGATCAAGCTG -3'
(R):5'- CTGGCGTAGAACACAGAGGGG -3'
Posted On2017-02-10