Incidental Mutation 'R0554:Grm1'
ID45374
Institutional Source Beutler Lab
Gene Symbol Grm1
Ensembl Gene ENSMUSG00000019828
Gene Nameglutamate receptor, metabotropic 1
SynonymsGrm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik
MMRRC Submission 038746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R0554 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location10686059-11082356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10719923 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 654 (T654S)
Ref Sequence ENSEMBL: ENSMUSP00000101190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]
Predicted Effect probably benign
Transcript: ENSMUST00000044306
AA Change: T654S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: T654S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 1.1e-94 PFAM
Pfam:Peripla_BP_6 151 340 1.4e-10 PFAM
Pfam:NCD3G 521 571 5.5e-16 PFAM
Pfam:7tm_3 604 837 2.4e-55 PFAM
low complexity region 969 975 N/A INTRINSIC
low complexity region 983 993 N/A INTRINSIC
low complexity region 1013 1033 N/A INTRINSIC
low complexity region 1071 1088 N/A INTRINSIC
low complexity region 1093 1109 N/A INTRINSIC
low complexity region 1126 1136 N/A INTRINSIC
GluR_Homer-bdg 1149 1199 6.85e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105560
AA Change: T654S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: T654S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105561
AA Change: T654S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: T654S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155772
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
1810024B03Rik A G 2: 127,187,276 M1T probably null Het
4930503L19Rik T C 18: 70,467,380 D386G probably damaging Het
Ace2 T A X: 164,175,951 N601K probably benign Het
Adam4 A C 12: 81,421,424 I141R probably damaging Het
Adcy10 G A 1: 165,513,130 G235S probably benign Het
Adcy5 G A 16: 35,294,017 V997I probably benign Het
Aff2 T G X: 69,864,074 W1221G possibly damaging Het
Ankrd44 T C 1: 54,763,758 N194D probably benign Het
Apba2 T G 7: 64,745,780 L668R probably damaging Het
Asph T C 4: 9,604,581 D152G probably damaging Het
Bcl3 C G 7: 19,820,066 V126L probably benign Het
Cd163 A G 6: 124,312,660 T446A probably benign Het
Cd209g C T 8: 4,134,995 probably benign Het
Cdadc1 A T 14: 59,586,452 V197E probably damaging Het
CN725425 T C 15: 91,260,763 C610R possibly damaging Het
Col6a2 A G 10: 76,611,161 probably null Het
Coro7 A G 16: 4,632,257 L576P possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Dhx57 A T 17: 80,260,236 L806* probably null Het
Dlec1 T C 9: 119,115,002 V373A probably benign Het
Dnah11 G T 12: 117,931,178 R3645S probably benign Het
Dnhd1 T C 7: 105,694,395 S1649P probably benign Het
Draxin T G 4: 148,107,963 K297N probably damaging Het
Epha7 T C 4: 28,951,401 S841P probably damaging Het
Esp8 T G 17: 40,530,275 D142E unknown Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Fancc T C 13: 63,317,469 S475G probably benign Het
Fmo3 T C 1: 162,954,332 N484S probably benign Het
Focad T C 4: 88,348,889 Y1046H unknown Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Fut8 A T 12: 77,364,970 I69L probably benign Het
Gm10436 T C 12: 88,177,558 T162A probably benign Het
Gm4951 G A 18: 60,245,417 R8H probably benign Het
Gnai3 A G 3: 108,123,612 I78T probably benign Het
Gpr182 T C 10: 127,751,071 I4V probably benign Het
Gpr63 T C 4: 25,007,447 M57T probably benign Het
Gtf2h4 T C 17: 35,668,639 T371A probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hmcn1 T C 1: 150,719,117 N1867S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j A G 11: 3,499,644 Y713H probably damaging Het
Ints6 A T 14: 62,704,751 V511D possibly damaging Het
Itga4 A G 2: 79,279,117 Y220C probably damaging Het
Itgav T G 2: 83,794,270 S735A possibly damaging Het
Kctd16 A G 18: 40,258,439 I27V probably benign Het
Klhl6 T C 16: 19,953,593 E334G probably damaging Het
Lrmp G A 6: 145,165,287 A237T probably benign Het
Ltbp1 T A 17: 75,225,279 L116H probably damaging Het
Magohb T A 6: 131,285,697 H98L probably benign Het
Mgat2 A G 12: 69,185,392 T247A probably benign Het
Mtif2 G A 11: 29,533,398 probably null Het
Myrfl T C 10: 116,828,973 E384G probably damaging Het
Nfam1 G T 15: 83,033,209 R8S probably benign Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1022 T C 2: 85,869,519 F309S probably benign Het
Olfr310 A T 7: 86,269,657 I44N probably damaging Het
Olfr317 T C 11: 58,733,039 N42S probably damaging Het
Olfr777 T C 10: 129,268,499 T275A probably benign Het
Orc4 C T 2: 48,905,421 S431N probably benign Het
Pax2 T C 19: 44,761,861 V129A probably damaging Het
Pcdhb15 A G 18: 37,474,519 D268G probably damaging Het
Pdcd1 G A 1: 94,039,382 R264C probably damaging Het
Pi15 T A 1: 17,621,648 M187K probably benign Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plagl1 A G 10: 13,127,182 T65A probably benign Het
Prss48 T A 3: 86,000,921 Q18L probably benign Het
Prune2 T A 19: 17,125,218 C2580* probably null Het
Rab40b T A 11: 121,359,606 Q74L probably damaging Het
Raf1 A G 6: 115,623,530 I376T probably benign Het
Rbm46 A T 3: 82,865,268 F186I probably damaging Het
Reps1 C T 10: 18,123,119 T720M possibly damaging Het
Rgs22 A G 15: 36,054,709 M649T probably benign Het
Rhot1 C T 11: 80,243,438 R47* probably null Het
Rhox2f A G X: 37,571,471 Y8C possibly damaging Het
Rnf17 A G 14: 56,522,550 Y1604C probably damaging Het
Rnf40 T C 7: 127,602,584 C943R probably damaging Het
Ropn1l A T 15: 31,451,149 M63K probably benign Het
Sbf2 C A 7: 110,428,287 V501F probably damaging Het
Sh3bp1 T A 15: 78,907,267 M354K probably damaging Het
Sipa1l3 T C 7: 29,388,030 H590R possibly damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Sulf1 T C 1: 12,805,194 Y143H probably damaging Het
Tiam2 A T 17: 3,438,681 R755* probably null Het
Trim12c C A 7: 104,344,962 L228F probably damaging Het
Ttc23l G T 15: 10,530,657 Q290K probably benign Het
Uba3 T C 6: 97,191,260 probably null Het
Ugt1a10 A G 1: 88,056,095 E205G probably damaging Het
Ugt3a2 T A 15: 9,351,120 S72T probably benign Het
Upk3bl C T 5: 136,059,794 T113I probably damaging Het
Uspl1 T A 5: 149,187,834 D20E probably damaging Het
Vmn2r19 G A 6: 123,336,143 G724E probably damaging Het
Vmn2r63 T A 7: 42,933,705 K29* probably null Het
Vwf C T 6: 125,642,781 A1474V probably benign Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Zfp536 T C 7: 37,480,819 D787G probably damaging Het
Zfp692 A G 11: 58,314,227 H434R probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Grm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Grm1 APN 10 10720039 missense probably benign 0.01
IGL02078:Grm1 APN 10 10689610 missense probably benign 0.02
IGL02156:Grm1 APN 10 10719976 missense probably damaging 0.99
IGL02476:Grm1 APN 10 10689453 missense probably benign 0.29
IGL02498:Grm1 APN 10 10719979 missense probably damaging 1.00
IGL02621:Grm1 APN 10 10689011 nonsense probably null
IGL03192:Grm1 APN 10 11079916 missense possibly damaging 0.66
IGL03342:Grm1 APN 10 11079971 missense probably benign 0.08
dewey UTSW 10 10719595 missense probably damaging 1.00
Dingus UTSW 10 10719967 missense probably benign 0.06
donald UTSW 10 10741508 nonsense probably null
jim UTSW 10 10719805 missense probably damaging 1.00
lightness UTSW 10 11079958 missense probably damaging 1.00
IGL02796:Grm1 UTSW 10 10689667 missense probably benign
R0294:Grm1 UTSW 10 11080399 missense probably damaging 1.00
R0525:Grm1 UTSW 10 10719209 splice site probably benign
R1184:Grm1 UTSW 10 10720034 missense probably benign 0.40
R1319:Grm1 UTSW 10 10689398 missense probably benign 0.05
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1494:Grm1 UTSW 10 10689706 missense probably benign 0.04
R1589:Grm1 UTSW 10 10719967 missense probably benign 0.06
R1615:Grm1 UTSW 10 10741508 nonsense probably null
R1720:Grm1 UTSW 10 10746794 splice site probably null
R1738:Grm1 UTSW 10 10936419 missense probably damaging 1.00
R1763:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R1774:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R2041:Grm1 UTSW 10 10746603 missense probably damaging 0.98
R2092:Grm1 UTSW 10 10689225 missense probably benign 0.00
R2198:Grm1 UTSW 10 10782776 missense probably damaging 1.00
R2297:Grm1 UTSW 10 11080414 missense probably benign 0.03
R2333:Grm1 UTSW 10 10719346 missense probably damaging 0.98
R2333:Grm1 UTSW 10 10719619 missense probably benign 0.31
R2914:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3105:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3106:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3705:Grm1 UTSW 10 10782729 missense possibly damaging 0.95
R3931:Grm1 UTSW 10 10719878 missense probably benign 0.44
R4810:Grm1 UTSW 10 10782694 missense probably damaging 1.00
R4892:Grm1 UTSW 10 10719587 missense possibly damaging 0.81
R4938:Grm1 UTSW 10 10936513 missense probably damaging 1.00
R4947:Grm1 UTSW 10 10782633 missense probably damaging 1.00
R4966:Grm1 UTSW 10 10719665 nonsense probably null
R5152:Grm1 UTSW 10 11079875 missense probably benign 0.13
R5283:Grm1 UTSW 10 10733192 missense possibly damaging 0.70
R5317:Grm1 UTSW 10 10746699 missense possibly damaging 0.77
R5374:Grm1 UTSW 10 11080442 missense probably benign 0.14
R5428:Grm1 UTSW 10 10719563 missense probably damaging 1.00
R5604:Grm1 UTSW 10 10746735 missense probably damaging 1.00
R5894:Grm1 UTSW 10 11080255 missense probably damaging 1.00
R5896:Grm1 UTSW 10 11080550 utr 5 prime probably benign
R5899:Grm1 UTSW 10 10689348 missense probably benign
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6139:Grm1 UTSW 10 10746331 intron probably benign
R6144:Grm1 UTSW 10 11079896 missense probably benign 0.08
R6208:Grm1 UTSW 10 10719946 missense probably damaging 1.00
R6976:Grm1 UTSW 10 10689180 missense probably benign 0.00
R7027:Grm1 UTSW 10 10719595 missense probably damaging 1.00
R7079:Grm1 UTSW 10 11079958 missense probably damaging 1.00
R7286:Grm1 UTSW 10 10689696 missense probably benign 0.19
R7352:Grm1 UTSW 10 10719493 missense probably damaging 1.00
R7484:Grm1 UTSW 10 10746659 missense probably benign 0.06
R7838:Grm1 UTSW 10 11080352 missense probably benign 0.02
R8108:Grm1 UTSW 10 10720132 missense probably benign 0.01
R8379:Grm1 UTSW 10 10689135 missense possibly damaging 0.86
X0002:Grm1 UTSW 10 10936513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCATGATGATCAAGGTCACCAC -3'
(R):5'- GCAGGCTGTGAGCCCATTACTATC -3'

Sequencing Primer
(F):5'- CTAATCAGAATGGAGGCTATGATCAC -3'
(R):5'- GGAGTGACATAGAATCCATCATAGCC -3'
Posted On2013-06-11