Incidental Mutation 'R5848:Napg'
ID453741
Institutional Source Beutler Lab
Gene Symbol Napg
Ensembl Gene ENSMUSG00000024581
Gene NameN-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms2400003O04Rik, SNARE
MMRRC Submission 043225-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5848 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location62977836-62999450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62994369 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 265 (R265G)
Ref Sequence ENSEMBL: ENSMUSP00000122681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025474] [ENSMUST00000150267]
Predicted Effect probably benign
Transcript: ENSMUST00000025474
AA Change: R215G

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025474
Gene: ENSMUSG00000024581
AA Change: R215G

DomainStartEndE-ValueType
Pfam:SNAP 7 261 1e-30 PFAM
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124837
Predicted Effect possibly damaging
Transcript: ENSMUST00000150267
AA Change: R265G

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122681
Gene: ENSMUSG00000024581
AA Change: R265G

DomainStartEndE-ValueType
Pfam:SNAP 7 195 6.7e-23 PFAM
low complexity region 204 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155440
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes soluble NSF attachment protein gamma. The soluble NSF attachment proteins (SNAPs) enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. The product of this gene mediates platelet exocytosis and controls the membrane fusion events of this process.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik T C 4: 116,173,615 I72T probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Aadacl4 T A 4: 144,617,858 M68K probably benign Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Armc4 T A 18: 7,268,507 probably null Het
Cdcp1 T A 9: 123,183,705 H259L possibly damaging Het
Ckap4 T C 10: 84,533,490 Q126R probably benign Het
Clec18a C T 8: 111,075,461 V299I probably benign Het
D7Ertd443e A G 7: 134,349,722 I27T possibly damaging Het
Dlg2 T G 7: 92,444,527 D726E probably benign Het
Dnah8 T C 17: 30,728,191 I1856T possibly damaging Het
Espl1 G A 15: 102,322,576 V1837I probably benign Het
Fanca G T 8: 123,295,053 probably benign Het
Fer1l5 A G 1: 36,388,935 T437A probably benign Het
Gm10644 C A 8: 83,934,039 probably benign Het
Katnb1 A G 8: 95,098,712 S635G probably benign Het
Map3k12 A G 15: 102,504,235 V234A possibly damaging Het
Mks1 A G 11: 87,856,870 N193S probably benign Het
Mmp11 T C 10: 75,927,389 E151G probably damaging Het
Olfr49 A G 14: 54,282,565 F110S possibly damaging Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Pcdha7 G T 18: 36,975,083 C387F probably damaging Het
Pcdhb3 G T 18: 37,301,647 R222L probably benign Het
Phf2 A G 13: 48,820,070 M373T unknown Het
Plekha7 T C 7: 116,140,399 T636A probably damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf6 G A 5: 146,211,149 P353L probably benign Het
Sel1l3 A C 5: 53,184,808 L357V possibly damaging Het
Sh3rf3 T A 10: 58,984,153 M262K possibly damaging Het
Sorcs3 A T 19: 48,788,511 H994L probably damaging Het
Thsd7a A T 6: 12,503,923 C411S probably damaging Het
Ttn T C 2: 76,763,338 K20653E probably damaging Het
Ttn A G 2: 76,780,920 W15677R probably damaging Het
Ttn A C 2: 76,878,564 probably null Het
Ubr2 T C 17: 46,956,655 M1049V possibly damaging Het
Other mutations in Napg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Napg APN 18 62986445 missense probably benign 0.21
IGL02728:Napg APN 18 62994304 splice site probably benign
IGL02742:Napg APN 18 62986248 missense probably damaging 0.99
R0276:Napg UTSW 18 62986963 missense probably damaging 1.00
R0277:Napg UTSW 18 62986963 missense probably damaging 1.00
R0323:Napg UTSW 18 62986963 missense probably damaging 1.00
R0325:Napg UTSW 18 62986963 missense probably damaging 1.00
R0751:Napg UTSW 18 62994338 missense probably benign 0.04
R0988:Napg UTSW 18 62983360 splice site probably benign
R1184:Napg UTSW 18 62994338 missense probably benign 0.04
R1387:Napg UTSW 18 62986212 missense possibly damaging 0.50
R1678:Napg UTSW 18 62984072 critical splice donor site probably null
R1779:Napg UTSW 18 62982691 missense probably benign 0.33
R4723:Napg UTSW 18 62992492 critical splice donor site probably null
R5874:Napg UTSW 18 62978020 nonsense probably null
R5973:Napg UTSW 18 62994983 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCAGGTGTCCTTTAGAAGTTCC -3'
(R):5'- TTCCTCAGCATTCAGGAAACC -3'

Sequencing Primer
(F):5'- CAGGTGTCCTTTAGAAGTTCCTATAG -3'
(R):5'- GCATTCAGGAAACCAAACGTAAGAC -3'
Posted On2017-02-10