Incidental Mutation 'R5849:Kcnd3'
ID453756
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Namepotassium voltage-gated channel, Shal-related family, member 3
SynonymsKv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L
MMRRC Submission 044066-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5849 (G1)
Quality Score209
Status Validated
Chromosome3
Chromosomal Location105452330-105674002 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 105458795 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
Predicted Effect probably benign
Transcript: ENSMUST00000079169
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098761
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118360
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141694
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,498 D111G probably benign Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agbl1 T C 7: 76,325,098 S113P probably benign Het
Ak9 A G 10: 41,348,049 D486G probably benign Het
Arhgap11a T C 2: 113,834,847 S469G probably null Het
Ccdc144b A T 3: 36,032,877 D189E possibly damaging Het
Comtd1 C T 14: 21,848,120 G48D probably damaging Het
Cyp27a1 T C 1: 74,736,684 S343P probably damaging Het
Dcun1d1 T A 3: 35,916,184 probably benign Het
Dennd4c T C 4: 86,825,986 I1404T possibly damaging Het
Dlgap5 A G 14: 47,389,435 S766P possibly damaging Het
Ebf1 T A 11: 44,990,504 probably null Het
Flcn T A 11: 59,804,760 I4L probably damaging Het
Grin2c T C 11: 115,260,991 T48A probably benign Het
Hyal5 T A 6: 24,891,556 S456R probably benign Het
Igf1r A G 7: 68,190,033 D696G probably benign Het
Iqgap1 A T 7: 80,803,158 V13D probably benign Het
Itgal A G 7: 127,317,320 N728S probably benign Het
Kcnb1 T A 2: 167,106,026 I301F probably damaging Het
Kdm4a C T 4: 118,161,840 R393Q probably benign Het
Lcn9 G A 2: 25,823,256 probably null Het
Madcam1 T A 10: 79,664,990 M47K probably benign Het
Matn3 A G 12: 8,958,829 Q314R probably benign Het
Msh3 A T 13: 92,249,878 D826E possibly damaging Het
Muc4 A T 16: 32,774,839 T3088S possibly damaging Het
Mup3 T G 4: 62,086,935 probably null Het
Myo15b A G 11: 115,881,933 K1807E probably damaging Het
Myrip A G 9: 120,453,693 D688G probably damaging Het
Nup153 A G 13: 46,686,976 F1052S probably damaging Het
Olfr1013 A T 2: 85,770,424 I208F probably benign Het
Olfr1316 A T 2: 112,129,878 I311K probably benign Het
Olfr1336 A T 7: 6,460,994 I162F possibly damaging Het
Olfr584 T A 7: 103,085,521 M1K probably null Het
Oplah T A 15: 76,297,347 probably benign Het
Pacsin2 A G 15: 83,390,518 F120L possibly damaging Het
Ppp1r36 C A 12: 76,439,157 P363Q probably damaging Het
Rai1 C A 11: 60,190,521 H1804N possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf214 G A 9: 45,868,088 P455S probably damaging Het
Rnf220 T C 4: 117,277,612 T188A possibly damaging Het
S1pr4 C T 10: 81,499,323 V106M possibly damaging Het
Sall2 C A 14: 52,314,247 S495I probably benign Het
Sars2 A G 7: 28,744,258 E95G possibly damaging Het
Sema3f G A 9: 107,682,616 T693M probably damaging Het
Slfn2 C A 11: 83,069,576 T127K probably benign Het
Snrpe T A 1: 133,608,914 I43L probably benign Het
Srsf1 T C 11: 88,047,858 I7T possibly damaging Het
Ssbp1 T A 6: 40,476,903 probably benign Het
Stbd1 T G 5: 92,604,995 F115V probably benign Het
Stk11ip T A 1: 75,527,355 probably null Het
Taf1b T A 12: 24,500,525 N36K probably damaging Het
Tanc1 A T 2: 59,799,904 M743L probably benign Het
Tnfsf12 C A 11: 69,686,967 R208L probably damaging Het
Trafd1 T C 5: 121,373,471 D428G probably damaging Het
Trim24 A G 6: 37,957,729 E793G probably damaging Het
Tspan32 T C 7: 143,015,587 C100R probably damaging Het
Ttn T C 2: 76,746,242 D16442G probably damaging Het
Ube3c T A 5: 29,658,409 L894Q probably damaging Het
Wfs1 C G 5: 36,973,264 G213R probably damaging Het
Zfp384 G A 6: 125,024,099 A45T possibly damaging Het
Zfp865 G T 7: 5,031,087 K690N probably damaging Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105667001 nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105658709 missense probably damaging 0.99
R0483:Kcnd3 UTSW 3 105459626 missense probably damaging 1.00
R0544:Kcnd3 UTSW 3 105658759 missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105668186 missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105459752 missense probably damaging 1.00
R2030:Kcnd3 UTSW 3 105459537 missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105666999 missense probably benign 0.16
R2106:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2287:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105669126 missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2924:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3778:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105668225 missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4630:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105658754 missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105666928 intron probably benign
R7198:Kcnd3 UTSW 3 105459540 missense probably damaging 1.00
R7224:Kcnd3 UTSW 3 105669084 missense probably damaging 0.98
R7532:Kcnd3 UTSW 3 105668210 missense probably damaging 1.00
R7578:Kcnd3 UTSW 3 105459617 missense probably benign 0.08
R8022:Kcnd3 UTSW 3 105458873 missense probably benign 0.19
Z1177:Kcnd3 UTSW 3 105459570 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCTGGCCATGGGGACTTAC -3'
(R):5'- AAGAACTCCTTCTCTGTGCTAC -3'

Sequencing Primer
(F):5'- GGGACTTACTTTCTCACTTAGCAATG -3'
(R):5'- ATAGCGCTCCAGAGTGGTC -3'
Posted On2017-02-10