Incidental Mutation 'R5849:Zfp384'
ID 453769
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Name zinc finger protein 384
Synonyms Ciz, C130073D16Rik, Nmp4
MMRRC Submission 044066-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R5849 (G1)
Quality Score 131
Status Validated
Chromosome 6
Chromosomal Location 124986108-125014833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 125001062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 45 (A45T)
Ref Sequence ENSEMBL: ENSMUSP00000086354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428] [ENSMUST00000152752]
AlphaFold E9Q1A5
Predicted Effect possibly damaging
Transcript: ENSMUST00000046064
AA Change: A45T

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346
AA Change: A45T

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000054553
AA Change: A45T

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346
AA Change: A45T

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084275
AA Change: A45T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346
AA Change: A45T

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088308
AA Change: A45T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346
AA Change: A45T

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112424
AA Change: A45T

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346
AA Change: A45T

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112425
AA Change: A45T

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346
AA Change: A45T

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112427
AA Change: A45T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346
AA Change: A45T

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112428
AA Change: A45T

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346
AA Change: A45T

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145138
Predicted Effect possibly damaging
Transcript: ENSMUST00000152752
AA Change: A45T

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205110
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Agbl1 T C 7: 75,974,846 (GRCm39) S113P probably benign Het
Ak9 A G 10: 41,224,045 (GRCm39) D486G probably benign Het
Aopep A G 13: 63,163,312 (GRCm39) D111G probably benign Het
Arhgap11a T C 2: 113,665,192 (GRCm39) S469G probably null Het
Comtd1 C T 14: 21,898,188 (GRCm39) G48D probably damaging Het
Cyp27a1 T C 1: 74,775,843 (GRCm39) S343P probably damaging Het
Dcun1d1 T A 3: 35,970,333 (GRCm39) probably benign Het
Dennd4c T C 4: 86,744,223 (GRCm39) I1404T possibly damaging Het
Dlgap5 A G 14: 47,626,892 (GRCm39) S766P possibly damaging Het
Ebf1 T A 11: 44,881,331 (GRCm39) probably null Het
Flcn T A 11: 59,695,586 (GRCm39) I4L probably damaging Het
Gm57858 A T 3: 36,087,026 (GRCm39) D189E possibly damaging Het
Grin2c T C 11: 115,151,817 (GRCm39) T48A probably benign Het
Hyal5 T A 6: 24,891,555 (GRCm39) S456R probably benign Het
Igf1r A G 7: 67,839,781 (GRCm39) D696G probably benign Het
Iqgap1 A T 7: 80,452,906 (GRCm39) V13D probably benign Het
Itgal A G 7: 126,916,492 (GRCm39) N728S probably benign Het
Kcnb1 T A 2: 166,947,946 (GRCm39) I301F probably damaging Het
Kcnd3 A G 3: 105,366,111 (GRCm39) probably benign Het
Kdm4a C T 4: 118,019,037 (GRCm39) R393Q probably benign Het
Lcn9 G A 2: 25,713,268 (GRCm39) probably null Het
Madcam1 T A 10: 79,500,824 (GRCm39) M47K probably benign Het
Matn3 A G 12: 9,008,829 (GRCm39) Q314R probably benign Het
Msh3 A T 13: 92,386,386 (GRCm39) D826E possibly damaging Het
Muc4 A T 16: 32,595,213 (GRCm39) T3088S possibly damaging Het
Mup3 T G 4: 62,005,172 (GRCm39) probably null Het
Myo15b A G 11: 115,772,759 (GRCm39) K1807E probably damaging Het
Myrip A G 9: 120,282,759 (GRCm39) D688G probably damaging Het
Nup153 A G 13: 46,840,452 (GRCm39) F1052S probably damaging Het
Oplah T A 15: 76,181,547 (GRCm39) probably benign Het
Or4f14d A T 2: 111,960,223 (GRCm39) I311K probably benign Het
Or52r1c T A 7: 102,734,728 (GRCm39) M1K probably null Het
Or6z3 A T 7: 6,463,993 (GRCm39) I162F possibly damaging Het
Or9g19 A T 2: 85,600,768 (GRCm39) I208F probably benign Het
Pacsin2 A G 15: 83,274,719 (GRCm39) F120L possibly damaging Het
Ppp1r36 C A 12: 76,485,931 (GRCm39) P363Q probably damaging Het
Rai1 C A 11: 60,081,347 (GRCm39) H1804N possibly damaging Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rnf214 G A 9: 45,779,386 (GRCm39) P455S probably damaging Het
Rnf220 T C 4: 117,134,809 (GRCm39) T188A possibly damaging Het
S1pr4 C T 10: 81,335,157 (GRCm39) V106M possibly damaging Het
Sall2 C A 14: 52,551,704 (GRCm39) S495I probably benign Het
Sars2 A G 7: 28,443,683 (GRCm39) E95G possibly damaging Het
Sema3f G A 9: 107,559,815 (GRCm39) T693M probably damaging Het
Slfn2 C A 11: 82,960,402 (GRCm39) T127K probably benign Het
Snrpe T A 1: 133,536,652 (GRCm39) I43L probably benign Het
Srsf1 T C 11: 87,938,684 (GRCm39) I7T possibly damaging Het
Ssbp1 T A 6: 40,453,837 (GRCm39) probably benign Het
Stbd1 T G 5: 92,752,854 (GRCm39) F115V probably benign Het
Stk11ip T A 1: 75,503,999 (GRCm39) probably null Het
Taf1b T A 12: 24,550,524 (GRCm39) N36K probably damaging Het
Tanc1 A T 2: 59,630,248 (GRCm39) M743L probably benign Het
Tnfsf12 C A 11: 69,577,793 (GRCm39) R208L probably damaging Het
Trafd1 T C 5: 121,511,534 (GRCm39) D428G probably damaging Het
Trim24 A G 6: 37,934,664 (GRCm39) E793G probably damaging Het
Tspan32 T C 7: 142,569,324 (GRCm39) C100R probably damaging Het
Ttn T C 2: 76,576,586 (GRCm39) D16442G probably damaging Het
Ube3c T A 5: 29,863,407 (GRCm39) L894Q probably damaging Het
Wfs1 C G 5: 37,130,608 (GRCm39) G213R probably damaging Het
Zfp865 G T 7: 5,034,086 (GRCm39) K690N probably damaging Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125,002,016 (GRCm39) missense probably benign 0.03
IGL01568:Zfp384 APN 6 125,001,095 (GRCm39) missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125,001,724 (GRCm39) missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125,012,676 (GRCm39) missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125,013,456 (GRCm39) unclassified probably benign
FR4340:Zfp384 UTSW 6 125,013,426 (GRCm39) unclassified probably benign
R0839:Zfp384 UTSW 6 125,013,631 (GRCm39) missense probably benign 0.01
R1370:Zfp384 UTSW 6 125,013,416 (GRCm39) missense probably benign 0.04
R1427:Zfp384 UTSW 6 125,001,847 (GRCm39) missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125,013,612 (GRCm39) missense probably benign 0.01
R2986:Zfp384 UTSW 6 125,001,859 (GRCm39) missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125,010,200 (GRCm39) splice site probably benign
R4833:Zfp384 UTSW 6 125,007,811 (GRCm39) missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125,007,893 (GRCm39) synonymous silent
R5084:Zfp384 UTSW 6 125,000,642 (GRCm39) splice site probably benign
R5137:Zfp384 UTSW 6 125,013,472 (GRCm39) unclassified probably benign
R5449:Zfp384 UTSW 6 125,001,101 (GRCm39) missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125,013,472 (GRCm39) unclassified probably benign
R5720:Zfp384 UTSW 6 125,013,587 (GRCm39) missense probably benign 0.19
R5961:Zfp384 UTSW 6 125,000,997 (GRCm39) missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125,001,896 (GRCm39) splice site probably null
R6948:Zfp384 UTSW 6 125,001,873 (GRCm39) missense probably benign 0.08
R7106:Zfp384 UTSW 6 125,001,222 (GRCm39) missense probably benign 0.23
R7192:Zfp384 UTSW 6 125,010,275 (GRCm39) missense probably damaging 1.00
R7320:Zfp384 UTSW 6 125,001,793 (GRCm39) missense possibly damaging 0.92
R7730:Zfp384 UTSW 6 125,008,635 (GRCm39) missense probably benign 0.02
R7861:Zfp384 UTSW 6 125,013,288 (GRCm39) missense probably damaging 1.00
R8080:Zfp384 UTSW 6 125,013,521 (GRCm39) missense unknown
R9021:Zfp384 UTSW 6 125,013,336 (GRCm39) missense
R9568:Zfp384 UTSW 6 125,001,796 (GRCm39) missense possibly damaging 0.70
R9606:Zfp384 UTSW 6 125,007,802 (GRCm39) missense possibly damaging 0.85
RF002:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,446 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,439 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF010:Zfp384 UTSW 6 125,013,451 (GRCm39) unclassified probably benign
RF010:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF011:Zfp384 UTSW 6 125,013,439 (GRCm39) unclassified probably benign
RF014:Zfp384 UTSW 6 125,013,429 (GRCm39) unclassified probably benign
RF015:Zfp384 UTSW 6 125,013,444 (GRCm39) unclassified probably benign
RF018:Zfp384 UTSW 6 125,013,452 (GRCm39) unclassified probably benign
RF020:Zfp384 UTSW 6 125,013,451 (GRCm39) unclassified probably benign
RF020:Zfp384 UTSW 6 125,013,418 (GRCm39) unclassified probably benign
RF022:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF024:Zfp384 UTSW 6 125,013,452 (GRCm39) unclassified probably benign
RF026:Zfp384 UTSW 6 125,013,455 (GRCm39) unclassified probably benign
RF027:Zfp384 UTSW 6 125,013,453 (GRCm39) unclassified probably benign
RF030:Zfp384 UTSW 6 125,013,446 (GRCm39) unclassified probably benign
RF056:Zfp384 UTSW 6 125,013,453 (GRCm39) unclassified probably benign
RF057:Zfp384 UTSW 6 125,013,459 (GRCm39) unclassified probably benign
RF062:Zfp384 UTSW 6 125,013,429 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TACTGAGAGTTGCATGGCATG -3'
(R):5'- TTACCCGCAGTCATGAGTCC -3'

Sequencing Primer
(F):5'- GTCTGGCTCCTGTCCAGAAAC -3'
(R):5'- CCGCAGTCATGAGTCCTGTAGATG -3'
Posted On 2017-02-10