Mutagenetix > Incidental Mutation

Incidental Mutation 'R5849:Agbl1'

453774

Institutional Source

Beutler Lab

Gene Symbol

Agbl1

Ensembl Gene

ENSMUSG00000025754

Gene Name

ATP/GTP binding protein-like 1

Synonyms

Nna1-l1, EG244071

MMRRC Submission

044066-MU

Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5849 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76229887-77124698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76325098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 113 (S113P)

Ref Sequence

ENSEMBL: ENSMUSP00000119721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000156166]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000156166
AA Change: S113P

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: S113P

Domain	Start	End	E-Value	Type
low complexity region	254	270	N/A	INTRINSIC

Meta Mutation Damage Score

0.1031

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,015,498	D111G	probably benign	Het
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ak9	A	G	10: 41,348,049	D486G	probably benign	Het
Arhgap11a	T	C	2: 113,834,847	S469G	probably null	Het
Ccdc144b	A	T	3: 36,032,877	D189E	possibly damaging	Het
Comtd1	C	T	14: 21,848,120	G48D	probably damaging	Het
Cyp27a1	T	C	1: 74,736,684	S343P	probably damaging	Het
Dcun1d1	T	A	3: 35,916,184		probably benign	Het
Dennd4c	T	C	4: 86,825,986	I1404T	possibly damaging	Het
Dlgap5	A	G	14: 47,389,435	S766P	possibly damaging	Het
Ebf1	T	A	11: 44,990,504		probably null	Het
Flcn	T	A	11: 59,804,760	I4L	probably damaging	Het
Grin2c	T	C	11: 115,260,991	T48A	probably benign	Het
Hyal5	T	A	6: 24,891,556	S456R	probably benign	Het
Igf1r	A	G	7: 68,190,033	D696G	probably benign	Het
Iqgap1	A	T	7: 80,803,158	V13D	probably benign	Het
Itgal	A	G	7: 127,317,320	N728S	probably benign	Het
Kcnb1	T	A	2: 167,106,026	I301F	probably damaging	Het
Kcnd3	A	G	3: 105,458,795		probably benign	Het
Kdm4a	C	T	4: 118,161,840	R393Q	probably benign	Het
Lcn9	G	A	2: 25,823,256		probably null	Het
Madcam1	T	A	10: 79,664,990	M47K	probably benign	Het
Matn3	A	G	12: 8,958,829	Q314R	probably benign	Het
Msh3	A	T	13: 92,249,878	D826E	possibly damaging	Het
Muc4	A	T	16: 32,774,839	T3088S	possibly damaging	Het
Mup3	T	G	4: 62,086,935		probably null	Het
Myo15b	A	G	11: 115,881,933	K1807E	probably damaging	Het
Myrip	A	G	9: 120,453,693	D688G	probably damaging	Het
Nup153	A	G	13: 46,686,976	F1052S	probably damaging	Het
Olfr1013	A	T	2: 85,770,424	I208F	probably benign	Het
Olfr1316	A	T	2: 112,129,878	I311K	probably benign	Het
Olfr1336	A	T	7: 6,460,994	I162F	possibly damaging	Het
Olfr584	T	A	7: 103,085,521	M1K	probably null	Het
Oplah	T	A	15: 76,297,347		probably benign	Het
Pacsin2	A	G	15: 83,390,518	F120L	possibly damaging	Het
Ppp1r36	C	A	12: 76,439,157	P363Q	probably damaging	Het
Rai1	C	A	11: 60,190,521	H1804N	possibly damaging	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rnf214	G	A	9: 45,868,088	P455S	probably damaging	Het
Rnf220	T	C	4: 117,277,612	T188A	possibly damaging	Het
S1pr4	C	T	10: 81,499,323	V106M	possibly damaging	Het
Sall2	C	A	14: 52,314,247	S495I	probably benign	Het
Sars2	A	G	7: 28,744,258	E95G	possibly damaging	Het
Sema3f	G	A	9: 107,682,616	T693M	probably damaging	Het
Slfn2	C	A	11: 83,069,576	T127K	probably benign	Het
Snrpe	T	A	1: 133,608,914	I43L	probably benign	Het
Srsf1	T	C	11: 88,047,858	I7T	possibly damaging	Het
Ssbp1	T	A	6: 40,476,903		probably benign	Het
Stbd1	T	G	5: 92,604,995	F115V	probably benign	Het
Stk11ip	T	A	1: 75,527,355		probably null	Het
Taf1b	T	A	12: 24,500,525	N36K	probably damaging	Het
Tanc1	A	T	2: 59,799,904	M743L	probably benign	Het
Tnfsf12	C	A	11: 69,686,967	R208L	probably damaging	Het
Trafd1	T	C	5: 121,373,471	D428G	probably damaging	Het
Trim24	A	G	6: 37,957,729	E793G	probably damaging	Het
Tspan32	T	C	7: 143,015,587	C100R	probably damaging	Het
Ttn	T	C	2: 76,746,242	D16442G	probably damaging	Het
Ube3c	T	A	5: 29,658,409	L894Q	probably damaging	Het
Wfs1	C	G	5: 36,973,264	G213R	probably damaging	Het
Zfp384	G	A	6: 125,024,099	A45T	possibly damaging	Het
Zfp865	G	T	7: 5,031,087	K690N	probably damaging	Het

Other mutations in Agbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01567:Agbl1	APN	7	76421880	missense	probably benign	0.01
IGL01650:Agbl1	APN	7	76420319	missense	probably damaging	1.00
IGL02244:Agbl1	APN	7	76766372	missense	probably damaging	1.00
IGL03088:Agbl1	APN	7	76720142	missense	probably benign	0.12
IGL03143:Agbl1	APN	7	76420045	nonsense	probably null
IGL03306:Agbl1	APN	7	76589504	missense	probably damaging	1.00
R0001:Agbl1	UTSW	7	76419863	missense	probably damaging	0.98
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0541:Agbl1	UTSW	7	76409245	missense	probably benign	0.22
R1889:Agbl1	UTSW	7	76589381	missense	probably damaging	1.00
R2089:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2127:Agbl1	UTSW	7	76419880	missense	possibly damaging	0.64
R2148:Agbl1	UTSW	7	76414717	splice site	probably null
R2229:Agbl1	UTSW	7	76433378	missense	probably benign	0.43
R2243:Agbl1	UTSW	7	76418722	missense	possibly damaging	0.93
R2255:Agbl1	UTSW	7	76422184	missense	probably damaging	1.00
R2411:Agbl1	UTSW	7	76720150	missense	probably damaging	1.00
R2426:Agbl1	UTSW	7	76421902	missense	probably damaging	1.00
R2508:Agbl1	UTSW	7	76589550	critical splice donor site	probably null
R2910:Agbl1	UTSW	7	76419838	missense	probably benign	0.13
R2919:Agbl1	UTSW	7	76414658	missense	probably damaging	1.00
R3056:Agbl1	UTSW	7	76766484	missense	possibly damaging	0.60
R3153:Agbl1	UTSW	7	76720196	missense	probably damaging	1.00
R3770:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R3825:Agbl1	UTSW	7	76419967	missense	probably damaging	0.99
R4632:Agbl1	UTSW	7	76413685	missense	probably benign	0.00
R4857:Agbl1	UTSW	7	76419835	missense	probably benign	0.03
R4943:Agbl1	UTSW	7	76420016	missense	probably benign	0.01
R5055:Agbl1	UTSW	7	76413577	missense	probably damaging	1.00
R5071:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5072:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5074:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5095:Agbl1	UTSW	7	76720133	missense	probably damaging	0.96
R5133:Agbl1	UTSW	7	76422156	missense	probably benign	0.21
R5576:Agbl1	UTSW	7	76335237	missense	probably benign	0.03
R5665:Agbl1	UTSW	7	76589503	missense	probably damaging	1.00
R5924:Agbl1	UTSW	7	76409234	missense	probably benign	0.12
R6044:Agbl1	UTSW	7	76318120	missense	possibly damaging	0.56
R6117:Agbl1	UTSW	7	76698786	missense	probably damaging	1.00
R6144:Agbl1	UTSW	7	76420084	missense	probably benign	0.02
R6368:Agbl1	UTSW	7	76419830	missense	probably benign	0.25
R6806:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7455:Agbl1	UTSW	7	76424755	missense	unknown
R7459:Agbl1	UTSW	7	76420066	missense	not run
R7485:Agbl1	UTSW	7	76589493	missense	unknown
R7516:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7539:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R7561:Agbl1	UTSW	7	76698761	missense	unknown
R7630:Agbl1	UTSW	7	76886156	missense	unknown
R7655:Agbl1	UTSW	7	76409332	missense
R7656:Agbl1	UTSW	7	76409332	missense
R7658:Agbl1	UTSW	7	76766369	missense	unknown
R7681:Agbl1	UTSW	7	76444901	missense	unknown
R7694:Agbl1	UTSW	7	76698765	missense	unknown
R7773:Agbl1	UTSW	7	76698837	missense	unknown
R7981:Agbl1	UTSW	7	76444840	missense	unknown
R8208:Agbl1	UTSW	7	76720168	missense	unknown
R8317:Agbl1	UTSW	7	76422181	missense	unknown
R8406:Agbl1	UTSW	7	76418667	missense
R8432:Agbl1	UTSW	7	77124686	missense	unknown
R8704:Agbl1	UTSW	7	76589554	splice site	probably benign
R8830:Agbl1	UTSW	7	76335311	missense
R8985:Agbl1	UTSW	7	76320156	missense
R9113:Agbl1	UTSW	7	76589477	missense	unknown
R9170:Agbl1	UTSW	7	76335321	missense
R9229:Agbl1	UTSW	7	77124522	missense	unknown
R9255:Agbl1	UTSW	7	76766402	missense	unknown
R9391:Agbl1	UTSW	7	76421854	missense	unknown
R9646:Agbl1	UTSW	7	76425900	missense	unknown
Z1088:Agbl1	UTSW	7	76419904	missense	probably benign	0.00
Z1176:Agbl1	UTSW	7	76418685	missense
Z1177:Agbl1	UTSW	7	76720206	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGATGTATCTGGCTCCAATGGG -3'
(R):5'- GCCTCTGGATTGTCAGGTTC -3'

Sequencing Primer
(F):5'- AGGCTCAAAAGTGTCTTTGGC -3'
(R):5'- CCTTTATGTGTCTGAATGGGACCAC -3'

Posted On

2017-02-10