Incidental Mutation 'R5849:Rnf214'
ID453780
Institutional Source Beutler Lab
Gene Symbol Rnf214
Ensembl Gene ENSMUSG00000042790
Gene Namering finger protein 214
SynonymsD130054N24Rik
MMRRC Submission 044066-MU
Accession Numbers

Ncbi RefSeq: NM_178709.4; MGI:2444451

Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R5849 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45863425-45906911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45868088 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 455 (P455S)
Ref Sequence ENSEMBL: ENSMUSP00000149889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034591] [ENSMUST00000058720] [ENSMUST00000160699] [ENSMUST00000161187] [ENSMUST00000161203] [ENSMUST00000162369] [ENSMUST00000162699] [ENSMUST00000213659]
Predicted Effect probably benign
Transcript: ENSMUST00000034591
SMART Domains Protein: ENSMUSP00000034591
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 418 3.1e-46 PFAM
Pfam:TAXi_C 259 417 1.2e-13 PFAM
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058720
AA Change: P455S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060941
Gene: ENSMUSG00000042790
AA Change: P455S

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100407
Predicted Effect probably damaging
Transcript: ENSMUST00000160699
AA Change: P455S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123754
Gene: ENSMUSG00000042790
AA Change: P455S

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160868
Predicted Effect possibly damaging
Transcript: ENSMUST00000161187
AA Change: P300S

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124296
Gene: ENSMUSG00000042790
AA Change: P300S

DomainStartEndE-ValueType
coiled coil region 65 224 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 465 509 3.42e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161203
AA Change: P300S

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123995
Gene: ENSMUSG00000042790
AA Change: P300S

DomainStartEndE-ValueType
SCOP:d1eq1a_ 80 227 2e-5 SMART
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 500 544 3.42e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162369
AA Change: P455S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000162699
Predicted Effect probably benign
Transcript: ENSMUST00000213659
Meta Mutation Damage Score 0.1118 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 96% (72/75)
Allele List at MGI

All alleles(12) : Targeted(3) Gene trapped(9)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,498 D111G probably benign Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agbl1 T C 7: 76,325,098 S113P probably benign Het
Ak9 A G 10: 41,348,049 D486G probably benign Het
Arhgap11a T C 2: 113,834,847 S469G probably null Het
Ccdc144b A T 3: 36,032,877 D189E possibly damaging Het
Comtd1 C T 14: 21,848,120 G48D probably damaging Het
Cyp27a1 T C 1: 74,736,684 S343P probably damaging Het
Dcun1d1 T A 3: 35,916,184 probably benign Het
Dennd4c T C 4: 86,825,986 I1404T possibly damaging Het
Dlgap5 A G 14: 47,389,435 S766P possibly damaging Het
Ebf1 T A 11: 44,990,504 probably null Het
Flcn T A 11: 59,804,760 I4L probably damaging Het
Grin2c T C 11: 115,260,991 T48A probably benign Het
Hyal5 T A 6: 24,891,556 S456R probably benign Het
Igf1r A G 7: 68,190,033 D696G probably benign Het
Iqgap1 A T 7: 80,803,158 V13D probably benign Het
Itgal A G 7: 127,317,320 N728S probably benign Het
Kcnb1 T A 2: 167,106,026 I301F probably damaging Het
Kcnd3 A G 3: 105,458,795 probably benign Het
Kdm4a C T 4: 118,161,840 R393Q probably benign Het
Lcn9 G A 2: 25,823,256 probably null Het
Madcam1 T A 10: 79,664,990 M47K probably benign Het
Matn3 A G 12: 8,958,829 Q314R probably benign Het
Msh3 A T 13: 92,249,878 D826E possibly damaging Het
Muc4 A T 16: 32,774,839 T3088S possibly damaging Het
Mup3 T G 4: 62,086,935 probably null Het
Myo15b A G 11: 115,881,933 K1807E probably damaging Het
Myrip A G 9: 120,453,693 D688G probably damaging Het
Nup153 A G 13: 46,686,976 F1052S probably damaging Het
Olfr1013 A T 2: 85,770,424 I208F probably benign Het
Olfr1316 A T 2: 112,129,878 I311K probably benign Het
Olfr1336 A T 7: 6,460,994 I162F possibly damaging Het
Olfr584 T A 7: 103,085,521 M1K probably null Het
Oplah T A 15: 76,297,347 probably benign Het
Pacsin2 A G 15: 83,390,518 F120L possibly damaging Het
Ppp1r36 C A 12: 76,439,157 P363Q probably damaging Het
Rai1 C A 11: 60,190,521 H1804N possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf220 T C 4: 117,277,612 T188A possibly damaging Het
S1pr4 C T 10: 81,499,323 V106M possibly damaging Het
Sall2 C A 14: 52,314,247 S495I probably benign Het
Sars2 A G 7: 28,744,258 E95G possibly damaging Het
Sema3f G A 9: 107,682,616 T693M probably damaging Het
Slfn2 C A 11: 83,069,576 T127K probably benign Het
Snrpe T A 1: 133,608,914 I43L probably benign Het
Srsf1 T C 11: 88,047,858 I7T possibly damaging Het
Ssbp1 T A 6: 40,476,903 probably benign Het
Stbd1 T G 5: 92,604,995 F115V probably benign Het
Stk11ip T A 1: 75,527,355 probably null Het
Taf1b T A 12: 24,500,525 N36K probably damaging Het
Tanc1 A T 2: 59,799,904 M743L probably benign Het
Tnfsf12 C A 11: 69,686,967 R208L probably damaging Het
Trafd1 T C 5: 121,373,471 D428G probably damaging Het
Trim24 A G 6: 37,957,729 E793G probably damaging Het
Tspan32 T C 7: 143,015,587 C100R probably damaging Het
Ttn T C 2: 76,746,242 D16442G probably damaging Het
Ube3c T A 5: 29,658,409 L894Q probably damaging Het
Wfs1 C G 5: 36,973,264 G213R probably damaging Het
Zfp384 G A 6: 125,024,099 A45T possibly damaging Het
Zfp865 G T 7: 5,031,087 K690N probably damaging Het
Other mutations in Rnf214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Rnf214 APN 9 45899786 missense probably damaging 1.00
IGL02314:Rnf214 APN 9 45899807 missense probably benign 0.00
IGL02604:Rnf214 APN 9 45869543 missense probably damaging 1.00
IGL02739:Rnf214 APN 9 45869474 missense probably benign
Contorted UTSW 9 45868046 nonsense probably null
R0067:Rnf214 UTSW 9 45867498 critical splice donor site probably null
R0067:Rnf214 UTSW 9 45867498 critical splice donor site probably null
R0091:Rnf214 UTSW 9 45898493 critical splice acceptor site probably null
R0375:Rnf214 UTSW 9 45899823 missense probably damaging 0.97
R1027:Rnf214 UTSW 9 45899889 missense probably benign
R1850:Rnf214 UTSW 9 45869448 splice site probably benign
R2424:Rnf214 UTSW 9 45899798 missense probably damaging 0.99
R3751:Rnf214 UTSW 9 45867603 missense probably damaging 1.00
R3772:Rnf214 UTSW 9 45866634 missense possibly damaging 0.83
R4164:Rnf214 UTSW 9 45871912 missense probably damaging 0.99
R4969:Rnf214 UTSW 9 45896188 missense probably damaging 1.00
R5032:Rnf214 UTSW 9 45899744 critical splice donor site probably null
R5647:Rnf214 UTSW 9 45868046 nonsense probably null
R5894:Rnf214 UTSW 9 45866618 missense probably damaging 1.00
R6296:Rnf214 UTSW 9 45867821 missense probably benign 0.05
R6467:Rnf214 UTSW 9 45867588 missense probably damaging 0.97
R6533:Rnf214 UTSW 9 45900063 missense probably benign 0.00
R6621:Rnf214 UTSW 9 45896170 missense probably damaging 1.00
R6801:Rnf214 UTSW 9 45896105 missense probably damaging 1.00
R6940:Rnf214 UTSW 9 45890898 missense probably damaging 0.99
R7398:Rnf214 UTSW 9 45867547 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTTCTCCCATGTGAGCCAGG -3'
(R):5'- ATTCCTATATACTTTGGCCAGAAGG -3'

Sequencing Primer
(F):5'- CTCCCATGTGAGCCAGGAAGAG -3'
(R):5'- TTGCTGAACCTAGAACTCGG -3'
Posted On2017-02-10