Incidental Mutation 'R5849:Sema3f'
ID 453781
Institutional Source Beutler Lab
Gene Symbol Sema3f
Ensembl Gene ENSMUSG00000034684
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Synonyms Sema IV, Semak
MMRRC Submission 044066-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5849 (G1)
Quality Score 215
Status Validated
Chromosome 9
Chromosomal Location 107558699-107587674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 107559815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 693 (T693M)
Ref Sequence ENSEMBL: ENSMUSP00000079400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010205] [ENSMUST00000080560] [ENSMUST00000192271] [ENSMUST00000192727] [ENSMUST00000194039]
AlphaFold O88632
Predicted Effect probably benign
Transcript: ENSMUST00000010205
SMART Domains Protein: ENSMUSP00000010205
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
G_alpha 9 349 5.13e-223 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080560
AA Change: T693M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684
AA Change: T693M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 498 5.46e-206 SMART
PSI 516 568 1.87e-12 SMART
IGc2 586 654 3.79e-4 SMART
low complexity region 673 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192157
Predicted Effect probably benign
Transcript: ENSMUST00000192271
SMART Domains Protein: ENSMUSP00000141571
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192727
AA Change: T724M

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141865
Gene: ENSMUSG00000034684
AA Change: T724M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 529 3.31e-205 SMART
PSI 547 599 1.87e-12 SMART
IGc2 617 685 3.79e-4 SMART
low complexity region 704 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194146
Predicted Effect probably benign
Transcript: ENSMUST00000194424
Predicted Effect probably benign
Transcript: ENSMUST00000194039
SMART Domains Protein: ENSMUSP00000142221
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 185 2e-42 PFAM
Meta Mutation Damage Score 0.1066 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin loop and a C-terminal basic domain. This gene is expressed by the endothelial cells where it was found to act in an autocrine fashion to induce apoptosis, inhibit cell proliferation and survival, and function as an anti-tumorigenic agent. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Inactivation of this locus results in neuronal defects including impaired CNS axon pathfinding, and PNS and limbic system circuitry. Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Agbl1 T C 7: 75,974,846 (GRCm39) S113P probably benign Het
Ak9 A G 10: 41,224,045 (GRCm39) D486G probably benign Het
Aopep A G 13: 63,163,312 (GRCm39) D111G probably benign Het
Arhgap11a T C 2: 113,665,192 (GRCm39) S469G probably null Het
Comtd1 C T 14: 21,898,188 (GRCm39) G48D probably damaging Het
Cyp27a1 T C 1: 74,775,843 (GRCm39) S343P probably damaging Het
Dcun1d1 T A 3: 35,970,333 (GRCm39) probably benign Het
Dennd4c T C 4: 86,744,223 (GRCm39) I1404T possibly damaging Het
Dlgap5 A G 14: 47,626,892 (GRCm39) S766P possibly damaging Het
Ebf1 T A 11: 44,881,331 (GRCm39) probably null Het
Flcn T A 11: 59,695,586 (GRCm39) I4L probably damaging Het
Gm57858 A T 3: 36,087,026 (GRCm39) D189E possibly damaging Het
Grin2c T C 11: 115,151,817 (GRCm39) T48A probably benign Het
Hyal5 T A 6: 24,891,555 (GRCm39) S456R probably benign Het
Igf1r A G 7: 67,839,781 (GRCm39) D696G probably benign Het
Iqgap1 A T 7: 80,452,906 (GRCm39) V13D probably benign Het
Itgal A G 7: 126,916,492 (GRCm39) N728S probably benign Het
Kcnb1 T A 2: 166,947,946 (GRCm39) I301F probably damaging Het
Kcnd3 A G 3: 105,366,111 (GRCm39) probably benign Het
Kdm4a C T 4: 118,019,037 (GRCm39) R393Q probably benign Het
Lcn9 G A 2: 25,713,268 (GRCm39) probably null Het
Madcam1 T A 10: 79,500,824 (GRCm39) M47K probably benign Het
Matn3 A G 12: 9,008,829 (GRCm39) Q314R probably benign Het
Msh3 A T 13: 92,386,386 (GRCm39) D826E possibly damaging Het
Muc4 A T 16: 32,595,213 (GRCm39) T3088S possibly damaging Het
Mup3 T G 4: 62,005,172 (GRCm39) probably null Het
Myo15b A G 11: 115,772,759 (GRCm39) K1807E probably damaging Het
Myrip A G 9: 120,282,759 (GRCm39) D688G probably damaging Het
Nup153 A G 13: 46,840,452 (GRCm39) F1052S probably damaging Het
Oplah T A 15: 76,181,547 (GRCm39) probably benign Het
Or4f14d A T 2: 111,960,223 (GRCm39) I311K probably benign Het
Or52r1c T A 7: 102,734,728 (GRCm39) M1K probably null Het
Or6z3 A T 7: 6,463,993 (GRCm39) I162F possibly damaging Het
Or9g19 A T 2: 85,600,768 (GRCm39) I208F probably benign Het
Pacsin2 A G 15: 83,274,719 (GRCm39) F120L possibly damaging Het
Ppp1r36 C A 12: 76,485,931 (GRCm39) P363Q probably damaging Het
Rai1 C A 11: 60,081,347 (GRCm39) H1804N possibly damaging Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rnf214 G A 9: 45,779,386 (GRCm39) P455S probably damaging Het
Rnf220 T C 4: 117,134,809 (GRCm39) T188A possibly damaging Het
S1pr4 C T 10: 81,335,157 (GRCm39) V106M possibly damaging Het
Sall2 C A 14: 52,551,704 (GRCm39) S495I probably benign Het
Sars2 A G 7: 28,443,683 (GRCm39) E95G possibly damaging Het
Slfn2 C A 11: 82,960,402 (GRCm39) T127K probably benign Het
Snrpe T A 1: 133,536,652 (GRCm39) I43L probably benign Het
Srsf1 T C 11: 87,938,684 (GRCm39) I7T possibly damaging Het
Ssbp1 T A 6: 40,453,837 (GRCm39) probably benign Het
Stbd1 T G 5: 92,752,854 (GRCm39) F115V probably benign Het
Stk11ip T A 1: 75,503,999 (GRCm39) probably null Het
Taf1b T A 12: 24,550,524 (GRCm39) N36K probably damaging Het
Tanc1 A T 2: 59,630,248 (GRCm39) M743L probably benign Het
Tnfsf12 C A 11: 69,577,793 (GRCm39) R208L probably damaging Het
Trafd1 T C 5: 121,511,534 (GRCm39) D428G probably damaging Het
Trim24 A G 6: 37,934,664 (GRCm39) E793G probably damaging Het
Tspan32 T C 7: 142,569,324 (GRCm39) C100R probably damaging Het
Ttn T C 2: 76,576,586 (GRCm39) D16442G probably damaging Het
Ube3c T A 5: 29,863,407 (GRCm39) L894Q probably damaging Het
Wfs1 C G 5: 37,130,608 (GRCm39) G213R probably damaging Het
Zfp384 G A 6: 125,001,062 (GRCm39) A45T possibly damaging Het
Zfp865 G T 7: 5,034,086 (GRCm39) K690N probably damaging Het
Other mutations in Sema3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Sema3f APN 9 107,562,721 (GRCm39) missense probably benign 0.44
IGL01940:Sema3f APN 9 107,560,896 (GRCm39) unclassified probably benign
IGL02070:Sema3f APN 9 107,569,440 (GRCm39) missense probably damaging 1.00
IGL02381:Sema3f APN 9 107,569,594 (GRCm39) missense probably damaging 1.00
IGL02472:Sema3f APN 9 107,564,935 (GRCm39) missense probably damaging 1.00
IGL02557:Sema3f APN 9 107,564,411 (GRCm39) missense probably damaging 1.00
IGL02614:Sema3f APN 9 107,559,710 (GRCm39) missense probably benign 0.28
IGL02660:Sema3f APN 9 107,561,183 (GRCm39) missense probably benign 0.05
R1468:Sema3f UTSW 9 107,564,771 (GRCm39) unclassified probably benign
R1905:Sema3f UTSW 9 107,561,575 (GRCm39) missense probably damaging 1.00
R4728:Sema3f UTSW 9 107,582,639 (GRCm39) missense probably benign 0.00
R4772:Sema3f UTSW 9 107,566,919 (GRCm39) nonsense probably null
R4786:Sema3f UTSW 9 107,559,881 (GRCm39) missense probably benign 0.45
R4845:Sema3f UTSW 9 107,562,700 (GRCm39) missense probably damaging 1.00
R5418:Sema3f UTSW 9 107,569,820 (GRCm39) missense probably damaging 1.00
R5780:Sema3f UTSW 9 107,559,788 (GRCm39) missense probably damaging 0.98
R5929:Sema3f UTSW 9 107,569,392 (GRCm39) missense probably damaging 1.00
R6968:Sema3f UTSW 9 107,568,648 (GRCm39) critical splice acceptor site probably null
R7043:Sema3f UTSW 9 107,568,599 (GRCm39) missense possibly damaging 0.91
R7449:Sema3f UTSW 9 107,561,235 (GRCm39) missense probably damaging 1.00
R7526:Sema3f UTSW 9 107,566,927 (GRCm39) missense probably damaging 0.96
R7559:Sema3f UTSW 9 107,561,777 (GRCm39) missense possibly damaging 0.52
R7640:Sema3f UTSW 9 107,560,774 (GRCm39) missense probably benign 0.20
R7771:Sema3f UTSW 9 107,569,625 (GRCm39) missense possibly damaging 0.89
R7789:Sema3f UTSW 9 107,582,631 (GRCm39) missense probably benign 0.00
R8058:Sema3f UTSW 9 107,559,800 (GRCm39) missense probably benign 0.42
R8113:Sema3f UTSW 9 107,565,275 (GRCm39) missense possibly damaging 0.95
R9574:Sema3f UTSW 9 107,566,972 (GRCm39) missense possibly damaging 0.50
R9641:Sema3f UTSW 9 107,565,454 (GRCm39) missense unknown
R9674:Sema3f UTSW 9 107,566,947 (GRCm39) missense possibly damaging 0.69
R9799:Sema3f UTSW 9 107,562,562 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATACTGTCTTTGCAGGGGTAGG -3'
(R):5'- CACAAACGTGGTGGTCTCAC -3'

Sequencing Primer
(F):5'- GCTAGGCTGGTCCTATGCAG -3'
(R):5'- TCTCACCTGGAAGCTGGCTAG -3'
Posted On 2017-02-10