Incidental Mutation 'R5849:Matn3'
ID453796
Institutional Source Beutler Lab
Gene Symbol Matn3
Ensembl Gene ENSMUSG00000020583
Gene Namematrilin 3
Synonyms
MMRRC Submission 044066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5849 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location8947929-8972028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8958829 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 314 (Q314R)
Ref Sequence ENSEMBL: ENSMUSP00000020899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020899]
Predicted Effect probably benign
Transcript: ENSMUST00000020899
AA Change: Q314R

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020899
Gene: ENSMUSG00000020583
AA Change: Q314R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 76 255 5.06e-51 SMART
EGF 257 300 2.02e-1 SMART
EGF 304 342 4.1e-2 SMART
EGF 346 384 4.22e-4 SMART
EGF 388 426 1.21e-4 SMART
Matrilin_ccoil 433 479 8.93e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,498 D111G probably benign Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agbl1 T C 7: 76,325,098 S113P probably benign Het
Ak9 A G 10: 41,348,049 D486G probably benign Het
Arhgap11a T C 2: 113,834,847 S469G probably null Het
Ccdc144b A T 3: 36,032,877 D189E possibly damaging Het
Comtd1 C T 14: 21,848,120 G48D probably damaging Het
Cyp27a1 T C 1: 74,736,684 S343P probably damaging Het
Dcun1d1 T A 3: 35,916,184 probably benign Het
Dennd4c T C 4: 86,825,986 I1404T possibly damaging Het
Dlgap5 A G 14: 47,389,435 S766P possibly damaging Het
Ebf1 T A 11: 44,990,504 probably null Het
Flcn T A 11: 59,804,760 I4L probably damaging Het
Grin2c T C 11: 115,260,991 T48A probably benign Het
Hyal5 T A 6: 24,891,556 S456R probably benign Het
Igf1r A G 7: 68,190,033 D696G probably benign Het
Iqgap1 A T 7: 80,803,158 V13D probably benign Het
Itgal A G 7: 127,317,320 N728S probably benign Het
Kcnb1 T A 2: 167,106,026 I301F probably damaging Het
Kcnd3 A G 3: 105,458,795 probably benign Het
Kdm4a C T 4: 118,161,840 R393Q probably benign Het
Lcn9 G A 2: 25,823,256 probably null Het
Madcam1 T A 10: 79,664,990 M47K probably benign Het
Msh3 A T 13: 92,249,878 D826E possibly damaging Het
Muc4 A T 16: 32,774,839 T3088S possibly damaging Het
Mup3 T G 4: 62,086,935 probably null Het
Myo15b A G 11: 115,881,933 K1807E probably damaging Het
Myrip A G 9: 120,453,693 D688G probably damaging Het
Nup153 A G 13: 46,686,976 F1052S probably damaging Het
Olfr1013 A T 2: 85,770,424 I208F probably benign Het
Olfr1316 A T 2: 112,129,878 I311K probably benign Het
Olfr1336 A T 7: 6,460,994 I162F possibly damaging Het
Olfr584 T A 7: 103,085,521 M1K probably null Het
Oplah T A 15: 76,297,347 probably benign Het
Pacsin2 A G 15: 83,390,518 F120L possibly damaging Het
Ppp1r36 C A 12: 76,439,157 P363Q probably damaging Het
Rai1 C A 11: 60,190,521 H1804N possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf214 G A 9: 45,868,088 P455S probably damaging Het
Rnf220 T C 4: 117,277,612 T188A possibly damaging Het
S1pr4 C T 10: 81,499,323 V106M possibly damaging Het
Sall2 C A 14: 52,314,247 S495I probably benign Het
Sars2 A G 7: 28,744,258 E95G possibly damaging Het
Sema3f G A 9: 107,682,616 T693M probably damaging Het
Slfn2 C A 11: 83,069,576 T127K probably benign Het
Snrpe T A 1: 133,608,914 I43L probably benign Het
Srsf1 T C 11: 88,047,858 I7T possibly damaging Het
Ssbp1 T A 6: 40,476,903 probably benign Het
Stbd1 T G 5: 92,604,995 F115V probably benign Het
Stk11ip T A 1: 75,527,355 probably null Het
Taf1b T A 12: 24,500,525 N36K probably damaging Het
Tanc1 A T 2: 59,799,904 M743L probably benign Het
Tnfsf12 C A 11: 69,686,967 R208L probably damaging Het
Trafd1 T C 5: 121,373,471 D428G probably damaging Het
Trim24 A G 6: 37,957,729 E793G probably damaging Het
Tspan32 T C 7: 143,015,587 C100R probably damaging Het
Ttn T C 2: 76,746,242 D16442G probably damaging Het
Ube3c T A 5: 29,658,409 L894Q probably damaging Het
Wfs1 C G 5: 36,973,264 G213R probably damaging Het
Zfp384 G A 6: 125,024,099 A45T possibly damaging Het
Zfp865 G T 7: 5,031,087 K690N probably damaging Het
Other mutations in Matn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Matn3 APN 12 8952091 missense probably damaging 0.98
IGL02138:Matn3 APN 12 8967638 missense possibly damaging 0.93
IGL02442:Matn3 APN 12 8967678 nonsense probably null
IGL02736:Matn3 APN 12 8955422 missense possibly damaging 0.53
R0091:Matn3 UTSW 12 8952105 missense probably damaging 0.98
R0585:Matn3 UTSW 12 8961103 splice site probably benign
R0615:Matn3 UTSW 12 8963594 missense probably damaging 1.00
R1424:Matn3 UTSW 12 8961132 missense possibly damaging 0.91
R1571:Matn3 UTSW 12 8955466 missense probably damaging 1.00
R1844:Matn3 UTSW 12 8967662 missense possibly damaging 0.90
R1865:Matn3 UTSW 12 8952041 missense probably damaging 1.00
R1977:Matn3 UTSW 12 8961110 splice site probably benign
R3015:Matn3 UTSW 12 8952217 missense probably damaging 0.97
R3018:Matn3 UTSW 12 8963578 missense probably benign 0.02
R5180:Matn3 UTSW 12 8955374 missense probably benign 0.38
R5308:Matn3 UTSW 12 8952308 frame shift probably null
R5616:Matn3 UTSW 12 8948195 missense probably benign
R5816:Matn3 UTSW 12 8970571 missense probably damaging 1.00
R7065:Matn3 UTSW 12 8952472 missense probably damaging 0.99
R7206:Matn3 UTSW 12 8961170 missense probably benign 0.01
RF001:Matn3 UTSW 12 8958797 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTTGGTGGAAGAACAAGACC -3'
(R):5'- TGGAAAACTGACCCAAGTTCC -3'

Sequencing Primer
(F):5'- GACCAGAAATTCCATCAGTTCC -3'
(R):5'- GACCCAAGTTCCCAGTTTAGG -3'
Posted On2017-02-10