Mutagenetix > Incidental Mutation

Incidental Mutation 'R5849:2010111I01Rik'

453800

Institutional Source

Beutler Lab

Gene Symbol

2010111I01Rik

Ensembl Gene

ENSMUSG00000021458

Gene Name

RIKEN cDNA 2010111I01 gene

Synonyms

ApO, aminopeptidase O

MMRRC Submission

044066-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R5849 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62964893-63326096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63015498 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 111 (D111G)

Ref Sequence

ENSEMBL: ENSMUSP00000089148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000021911
AA Change: D111G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: D111G

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	221	359	5.4e-11	PFAM
Pfam:Peptidase_M1	385	558	2.3e-15	PFAM
Pfam:Peptidase_MA_2	453	613	1.3e-12	PFAM
Leuk-A4-hydro_C	675	821	3.02e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091560
AA Change: D111G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: D111G

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	220	359	2.7e-11	PFAM
Pfam:Peptidase_M1	386	561	1.9e-15	PFAM
Leuk-A4-hydro_C	676	822	3.02e-37	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000220863
AA Change: D2G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222181

Meta Mutation Damage Score

0.0580

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Agbl1	T	C	7: 76,325,098	S113P	probably benign	Het
Ak9	A	G	10: 41,348,049	D486G	probably benign	Het
Arhgap11a	T	C	2: 113,834,847	S469G	probably null	Het
Ccdc144b	A	T	3: 36,032,877	D189E	possibly damaging	Het
Comtd1	C	T	14: 21,848,120	G48D	probably damaging	Het
Cyp27a1	T	C	1: 74,736,684	S343P	probably damaging	Het
Dcun1d1	T	A	3: 35,916,184		probably benign	Het
Dennd4c	T	C	4: 86,825,986	I1404T	possibly damaging	Het
Dlgap5	A	G	14: 47,389,435	S766P	possibly damaging	Het
Ebf1	T	A	11: 44,990,504		probably null	Het
Flcn	T	A	11: 59,804,760	I4L	probably damaging	Het
Grin2c	T	C	11: 115,260,991	T48A	probably benign	Het
Hyal5	T	A	6: 24,891,556	S456R	probably benign	Het
Igf1r	A	G	7: 68,190,033	D696G	probably benign	Het
Iqgap1	A	T	7: 80,803,158	V13D	probably benign	Het
Itgal	A	G	7: 127,317,320	N728S	probably benign	Het
Kcnb1	T	A	2: 167,106,026	I301F	probably damaging	Het
Kcnd3	A	G	3: 105,458,795		probably benign	Het
Kdm4a	C	T	4: 118,161,840	R393Q	probably benign	Het
Lcn9	G	A	2: 25,823,256		probably null	Het
Madcam1	T	A	10: 79,664,990	M47K	probably benign	Het
Matn3	A	G	12: 8,958,829	Q314R	probably benign	Het
Msh3	A	T	13: 92,249,878	D826E	possibly damaging	Het
Muc4	A	T	16: 32,774,839	T3088S	possibly damaging	Het
Mup3	T	G	4: 62,086,935		probably null	Het
Myo15b	A	G	11: 115,881,933	K1807E	probably damaging	Het
Myrip	A	G	9: 120,453,693	D688G	probably damaging	Het
Nup153	A	G	13: 46,686,976	F1052S	probably damaging	Het
Olfr1013	A	T	2: 85,770,424	I208F	probably benign	Het
Olfr1316	A	T	2: 112,129,878	I311K	probably benign	Het
Olfr1336	A	T	7: 6,460,994	I162F	possibly damaging	Het
Olfr584	T	A	7: 103,085,521	M1K	probably null	Het
Oplah	T	A	15: 76,297,347		probably benign	Het
Pacsin2	A	G	15: 83,390,518	F120L	possibly damaging	Het
Ppp1r36	C	A	12: 76,439,157	P363Q	probably damaging	Het
Rai1	C	A	11: 60,190,521	H1804N	possibly damaging	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rnf214	G	A	9: 45,868,088	P455S	probably damaging	Het
Rnf220	T	C	4: 117,277,612	T188A	possibly damaging	Het
S1pr4	C	T	10: 81,499,323	V106M	possibly damaging	Het
Sall2	C	A	14: 52,314,247	S495I	probably benign	Het
Sars2	A	G	7: 28,744,258	E95G	possibly damaging	Het
Sema3f	G	A	9: 107,682,616	T693M	probably damaging	Het
Slfn2	C	A	11: 83,069,576	T127K	probably benign	Het
Snrpe	T	A	1: 133,608,914	I43L	probably benign	Het
Srsf1	T	C	11: 88,047,858	I7T	possibly damaging	Het
Ssbp1	T	A	6: 40,476,903		probably benign	Het
Stbd1	T	G	5: 92,604,995	F115V	probably benign	Het
Stk11ip	T	A	1: 75,527,355		probably null	Het
Taf1b	T	A	12: 24,500,525	N36K	probably damaging	Het
Tanc1	A	T	2: 59,799,904	M743L	probably benign	Het
Tnfsf12	C	A	11: 69,686,967	R208L	probably damaging	Het
Trafd1	T	C	5: 121,373,471	D428G	probably damaging	Het
Trim24	A	G	6: 37,957,729	E793G	probably damaging	Het
Tspan32	T	C	7: 143,015,587	C100R	probably damaging	Het
Ttn	T	C	2: 76,746,242	D16442G	probably damaging	Het
Ube3c	T	A	5: 29,658,409	L894Q	probably damaging	Het
Wfs1	C	G	5: 36,973,264	G213R	probably damaging	Het
Zfp384	G	A	6: 125,024,099	A45T	possibly damaging	Het
Zfp865	G	T	7: 5,031,087	K690N	probably damaging	Het

Other mutations in 2010111I01Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:2010111I01Rik	APN	13	63199500	splice site	probably benign
IGL00329:2010111I01Rik	APN	13	63191163	missense	probably damaging	1.00
IGL00336:2010111I01Rik	APN	13	63015423	missense	possibly damaging	0.78
IGL01384:2010111I01Rik	APN	13	63190476	splice site	probably benign
IGL01780:2010111I01Rik	APN	13	63210125	missense	probably benign	0.00
IGL01876:2010111I01Rik	APN	13	63190522	missense	probably damaging	1.00
IGL02096:2010111I01Rik	APN	13	63061089	missense	probably benign	0.04
IGL02166:2010111I01Rik	APN	13	63015453	missense	probably benign	0.02
IGL02184:2010111I01Rik	APN	13	63068111	missense	possibly damaging	0.50
PIT4378001:2010111I01Rik	UTSW	13	63015207	missense	probably damaging	1.00
R0139:2010111I01Rik	UTSW	13	63190484	missense	probably benign	0.01
R1209:2010111I01Rik	UTSW	13	63191064	splice site	probably null
R1233:2010111I01Rik	UTSW	13	63199520	missense	probably damaging	0.96
R1756:2010111I01Rik	UTSW	13	63068061	missense	possibly damaging	0.95
R1786:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R1861:2010111I01Rik	UTSW	13	63015783	missense	probably damaging	1.00
R2130:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R2131:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R3076:2010111I01Rik	UTSW	13	63240115	missense	probably damaging	0.96
R3702:2010111I01Rik	UTSW	13	63015330	missense	probably benign	0.01
R3912:2010111I01Rik	UTSW	13	63156706	nonsense	probably null
R4512:2010111I01Rik	UTSW	13	63156667	missense	probably damaging	0.99
R4593:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4596:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4597:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4616:2010111I01Rik	UTSW	13	63298751	missense	probably damaging	1.00
R4625:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4627:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4630:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4632:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4911:2010111I01Rik	UTSW	13	63170939	critical splice acceptor site	probably null
R5204:2010111I01Rik	UTSW	13	63033090	missense	probably benign	0.15
R5210:2010111I01Rik	UTSW	13	63068110	missense	probably benign	0.00
R5861:2010111I01Rik	UTSW	13	63298812	missense	probably damaging	1.00
R5960:2010111I01Rik	UTSW	13	63240273	missense	probably damaging	0.99
R6021:2010111I01Rik	UTSW	13	63061082	missense	probably damaging	1.00
R6048:2010111I01Rik	UTSW	13	63240325	missense	probably damaging	0.99
R6379:2010111I01Rik	UTSW	13	63068243	missense	probably damaging	0.97
R7038:2010111I01Rik	UTSW	13	63190525	missense	possibly damaging	0.54
R7493:2010111I01Rik	UTSW	13	63015531	missense	probably benign	0.01
R7788:2010111I01Rik	UTSW	13	63156593	missense	possibly damaging	0.89
R7970:2010111I01Rik	UTSW	13	63033160	missense	probably benign	0.11
R7988:2010111I01Rik	UTSW	13	63061140	missense	probably benign	0.00
R8041:2010111I01Rik	UTSW	13	63033107	missense	probably damaging	1.00
R8052:2010111I01Rik	UTSW	13	63068251	missense	probably damaging	1.00
R8053:2010111I01Rik	UTSW	13	63190531	nonsense	probably null
R8537:2010111I01Rik	UTSW	13	63190550	missense	probably damaging	1.00
R8554:2010111I01Rik	UTSW	13	63296897	missense	possibly damaging	0.94
R8681:2010111I01Rik	UTSW	13	63190559	missense	probably damaging	1.00
R8909:2010111I01Rik	UTSW	13	63240297	missense	possibly damaging	0.95
R8945:2010111I01Rik	UTSW	13	63240331	missense	probably null	1.00
R8990:2010111I01Rik	UTSW	13	63156614	missense	probably damaging	1.00
R9032:2010111I01Rik	UTSW	13	63296867	nonsense	probably null
R9049:2010111I01Rik	UTSW	13	63061038	missense	probably benign	0.00
R9166:2010111I01Rik	UTSW	13	63171048	critical splice donor site	probably null
R9590:2010111I01Rik	UTSW	13	63061109	missense	probably benign
Z1177:2010111I01Rik	UTSW	13	63170990	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATTGAGGGCAACATAGTGC -3'
(R):5'- GTAAATTTCTCAAGGCCTGGCAC -3'

Sequencing Primer
(F):5'- CATTGAGGGCAACATAGTGCTTTTC -3'
(R):5'- GCACAGCAGCCACATCC -3'

Posted On

2017-02-10