Mutagenetix > Incidental Mutation

Incidental Mutation 'R5849:Sall2'

453803

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

044066-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5849 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52314247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 495 (S495I)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably benign
Transcript: ENSMUST00000058326
AA Change: S497I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: S497I

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135523
AA Change: S495I

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,015,498	D111G	probably benign	Het
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Agbl1	T	C	7: 76,325,098	S113P	probably benign	Het
Ak9	A	G	10: 41,348,049	D486G	probably benign	Het
Arhgap11a	T	C	2: 113,834,847	S469G	probably null	Het
Ccdc144b	A	T	3: 36,032,877	D189E	possibly damaging	Het
Comtd1	C	T	14: 21,848,120	G48D	probably damaging	Het
Cyp27a1	T	C	1: 74,736,684	S343P	probably damaging	Het
Dcun1d1	T	A	3: 35,916,184		probably benign	Het
Dennd4c	T	C	4: 86,825,986	I1404T	possibly damaging	Het
Dlgap5	A	G	14: 47,389,435	S766P	possibly damaging	Het
Ebf1	T	A	11: 44,990,504		probably null	Het
Flcn	T	A	11: 59,804,760	I4L	probably damaging	Het
Grin2c	T	C	11: 115,260,991	T48A	probably benign	Het
Hyal5	T	A	6: 24,891,556	S456R	probably benign	Het
Igf1r	A	G	7: 68,190,033	D696G	probably benign	Het
Iqgap1	A	T	7: 80,803,158	V13D	probably benign	Het
Itgal	A	G	7: 127,317,320	N728S	probably benign	Het
Kcnb1	T	A	2: 167,106,026	I301F	probably damaging	Het
Kcnd3	A	G	3: 105,458,795		probably benign	Het
Kdm4a	C	T	4: 118,161,840	R393Q	probably benign	Het
Lcn9	G	A	2: 25,823,256		probably null	Het
Madcam1	T	A	10: 79,664,990	M47K	probably benign	Het
Matn3	A	G	12: 8,958,829	Q314R	probably benign	Het
Msh3	A	T	13: 92,249,878	D826E	possibly damaging	Het
Muc4	A	T	16: 32,774,839	T3088S	possibly damaging	Het
Mup3	T	G	4: 62,086,935		probably null	Het
Myo15b	A	G	11: 115,881,933	K1807E	probably damaging	Het
Myrip	A	G	9: 120,453,693	D688G	probably damaging	Het
Nup153	A	G	13: 46,686,976	F1052S	probably damaging	Het
Olfr1013	A	T	2: 85,770,424	I208F	probably benign	Het
Olfr1316	A	T	2: 112,129,878	I311K	probably benign	Het
Olfr1336	A	T	7: 6,460,994	I162F	possibly damaging	Het
Olfr584	T	A	7: 103,085,521	M1K	probably null	Het
Oplah	T	A	15: 76,297,347		probably benign	Het
Pacsin2	A	G	15: 83,390,518	F120L	possibly damaging	Het
Ppp1r36	C	A	12: 76,439,157	P363Q	probably damaging	Het
Rai1	C	A	11: 60,190,521	H1804N	possibly damaging	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rnf214	G	A	9: 45,868,088	P455S	probably damaging	Het
Rnf220	T	C	4: 117,277,612	T188A	possibly damaging	Het
S1pr4	C	T	10: 81,499,323	V106M	possibly damaging	Het
Sars2	A	G	7: 28,744,258	E95G	possibly damaging	Het
Sema3f	G	A	9: 107,682,616	T693M	probably damaging	Het
Slfn2	C	A	11: 83,069,576	T127K	probably benign	Het
Snrpe	T	A	1: 133,608,914	I43L	probably benign	Het
Srsf1	T	C	11: 88,047,858	I7T	possibly damaging	Het
Ssbp1	T	A	6: 40,476,903		probably benign	Het
Stbd1	T	G	5: 92,604,995	F115V	probably benign	Het
Stk11ip	T	A	1: 75,527,355		probably null	Het
Taf1b	T	A	12: 24,500,525	N36K	probably damaging	Het
Tanc1	A	T	2: 59,799,904	M743L	probably benign	Het
Tnfsf12	C	A	11: 69,686,967	R208L	probably damaging	Het
Trafd1	T	C	5: 121,373,471	D428G	probably damaging	Het
Trim24	A	G	6: 37,957,729	E793G	probably damaging	Het
Tspan32	T	C	7: 143,015,587	C100R	probably damaging	Het
Ttn	T	C	2: 76,746,242	D16442G	probably damaging	Het
Ube3c	T	A	5: 29,658,409	L894Q	probably damaging	Het
Wfs1	C	G	5: 36,973,264	G213R	probably damaging	Het
Zfp384	G	A	6: 125,024,099	A45T	possibly damaging	Het
Zfp865	G	T	7: 5,031,087	K690N	probably damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TTAGTAAGCAGTGCCCAACTCG -3'
(R):5'- TGAATCCACATCCAGTACCGG -3'

Sequencing Primer
(F):5'- CAACTCGGTAGTGACGTCAC -3'
(R):5'- GGAGCACCTAGACTACGTCATC -3'

Posted On

2017-02-10