Incidental Mutation 'R5849:Rictor'
ID453804
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 044066-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5849 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6794006 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1555 (E1555K)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: E1555K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: E1555K

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,498 D111G probably benign Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agbl1 T C 7: 76,325,098 S113P probably benign Het
Ak9 A G 10: 41,348,049 D486G probably benign Het
Arhgap11a T C 2: 113,834,847 S469G probably null Het
Ccdc144b A T 3: 36,032,877 D189E possibly damaging Het
Comtd1 C T 14: 21,848,120 G48D probably damaging Het
Cyp27a1 T C 1: 74,736,684 S343P probably damaging Het
Dcun1d1 T A 3: 35,916,184 probably benign Het
Dennd4c T C 4: 86,825,986 I1404T possibly damaging Het
Dlgap5 A G 14: 47,389,435 S766P possibly damaging Het
Ebf1 T A 11: 44,990,504 probably null Het
Flcn T A 11: 59,804,760 I4L probably damaging Het
Grin2c T C 11: 115,260,991 T48A probably benign Het
Hyal5 T A 6: 24,891,556 S456R probably benign Het
Igf1r A G 7: 68,190,033 D696G probably benign Het
Iqgap1 A T 7: 80,803,158 V13D probably benign Het
Itgal A G 7: 127,317,320 N728S probably benign Het
Kcnb1 T A 2: 167,106,026 I301F probably damaging Het
Kcnd3 A G 3: 105,458,795 probably benign Het
Kdm4a C T 4: 118,161,840 R393Q probably benign Het
Lcn9 G A 2: 25,823,256 probably null Het
Madcam1 T A 10: 79,664,990 M47K probably benign Het
Matn3 A G 12: 8,958,829 Q314R probably benign Het
Msh3 A T 13: 92,249,878 D826E possibly damaging Het
Muc4 A T 16: 32,774,839 T3088S possibly damaging Het
Mup3 T G 4: 62,086,935 probably null Het
Myo15b A G 11: 115,881,933 K1807E probably damaging Het
Myrip A G 9: 120,453,693 D688G probably damaging Het
Nup153 A G 13: 46,686,976 F1052S probably damaging Het
Olfr1013 A T 2: 85,770,424 I208F probably benign Het
Olfr1316 A T 2: 112,129,878 I311K probably benign Het
Olfr1336 A T 7: 6,460,994 I162F possibly damaging Het
Olfr584 T A 7: 103,085,521 M1K probably null Het
Oplah T A 15: 76,297,347 probably benign Het
Pacsin2 A G 15: 83,390,518 F120L possibly damaging Het
Ppp1r36 C A 12: 76,439,157 P363Q probably damaging Het
Rai1 C A 11: 60,190,521 H1804N possibly damaging Het
Rnf214 G A 9: 45,868,088 P455S probably damaging Het
Rnf220 T C 4: 117,277,612 T188A possibly damaging Het
S1pr4 C T 10: 81,499,323 V106M possibly damaging Het
Sall2 C A 14: 52,314,247 S495I probably benign Het
Sars2 A G 7: 28,744,258 E95G possibly damaging Het
Sema3f G A 9: 107,682,616 T693M probably damaging Het
Slfn2 C A 11: 83,069,576 T127K probably benign Het
Snrpe T A 1: 133,608,914 I43L probably benign Het
Srsf1 T C 11: 88,047,858 I7T possibly damaging Het
Ssbp1 T A 6: 40,476,903 probably benign Het
Stbd1 T G 5: 92,604,995 F115V probably benign Het
Stk11ip T A 1: 75,527,355 probably null Het
Taf1b T A 12: 24,500,525 N36K probably damaging Het
Tanc1 A T 2: 59,799,904 M743L probably benign Het
Tnfsf12 C A 11: 69,686,967 R208L probably damaging Het
Trafd1 T C 5: 121,373,471 D428G probably damaging Het
Trim24 A G 6: 37,957,729 E793G probably damaging Het
Tspan32 T C 7: 143,015,587 C100R probably damaging Het
Ttn T C 2: 76,746,242 D16442G probably damaging Het
Ube3c T A 5: 29,658,409 L894Q probably damaging Het
Wfs1 C G 5: 36,973,264 G213R probably damaging Het
Zfp384 G A 6: 125,024,099 A45T possibly damaging Het
Zfp865 G T 7: 5,031,087 K690N probably damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCATCCCTGGGCAATTCAG -3'
(R):5'- TTTCACTAATACCGACCTGCAGAG -3'

Sequencing Primer
(F):5'- GCAATTCAGGTTTCTTTGACAGTC -3'
(R):5'- TGCAGAGCCCGAGACAAC -3'
Posted On2017-02-10