Incidental Mutation 'R5849:Pacsin2'
ID453806
Institutional Source Beutler Lab
Gene Symbol Pacsin2
Ensembl Gene ENSMUSG00000016664
Gene Nameprotein kinase C and casein kinase substrate in neurons 2
SynonymsSyndapin II
MMRRC Submission 044066-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5849 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83375607-83464606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83390518 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 120 (F120L)
Ref Sequence ENSEMBL: ENSMUSP00000155334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056177] [ENSMUST00000165095] [ENSMUST00000171436] [ENSMUST00000229337] [ENSMUST00000230679] [ENSMUST00000230816] [ENSMUST00000231184]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056177
AA Change: F120L

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058320
Gene: ENSMUSG00000016664
AA Change: F120L

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165095
AA Change: F120L

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130098
Gene: ENSMUSG00000016664
AA Change: F120L

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171436
AA Change: F120L

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131504
Gene: ENSMUSG00000016664
AA Change: F120L

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000229337
AA Change: F120L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000230030
Predicted Effect possibly damaging
Transcript: ENSMUST00000230679
AA Change: F120L

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230816
AA Change: F120L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231043
Predicted Effect possibly damaging
Transcript: ENSMUST00000231184
AA Change: F120L

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.2919 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation by regulating tubulin polymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,498 D111G probably benign Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agbl1 T C 7: 76,325,098 S113P probably benign Het
Ak9 A G 10: 41,348,049 D486G probably benign Het
Arhgap11a T C 2: 113,834,847 S469G probably null Het
Ccdc144b A T 3: 36,032,877 D189E possibly damaging Het
Comtd1 C T 14: 21,848,120 G48D probably damaging Het
Cyp27a1 T C 1: 74,736,684 S343P probably damaging Het
Dcun1d1 T A 3: 35,916,184 probably benign Het
Dennd4c T C 4: 86,825,986 I1404T possibly damaging Het
Dlgap5 A G 14: 47,389,435 S766P possibly damaging Het
Ebf1 T A 11: 44,990,504 probably null Het
Flcn T A 11: 59,804,760 I4L probably damaging Het
Grin2c T C 11: 115,260,991 T48A probably benign Het
Hyal5 T A 6: 24,891,556 S456R probably benign Het
Igf1r A G 7: 68,190,033 D696G probably benign Het
Iqgap1 A T 7: 80,803,158 V13D probably benign Het
Itgal A G 7: 127,317,320 N728S probably benign Het
Kcnb1 T A 2: 167,106,026 I301F probably damaging Het
Kcnd3 A G 3: 105,458,795 probably benign Het
Kdm4a C T 4: 118,161,840 R393Q probably benign Het
Lcn9 G A 2: 25,823,256 probably null Het
Madcam1 T A 10: 79,664,990 M47K probably benign Het
Matn3 A G 12: 8,958,829 Q314R probably benign Het
Msh3 A T 13: 92,249,878 D826E possibly damaging Het
Muc4 A T 16: 32,774,839 T3088S possibly damaging Het
Mup3 T G 4: 62,086,935 probably null Het
Myo15b A G 11: 115,881,933 K1807E probably damaging Het
Myrip A G 9: 120,453,693 D688G probably damaging Het
Nup153 A G 13: 46,686,976 F1052S probably damaging Het
Olfr1013 A T 2: 85,770,424 I208F probably benign Het
Olfr1316 A T 2: 112,129,878 I311K probably benign Het
Olfr1336 A T 7: 6,460,994 I162F possibly damaging Het
Olfr584 T A 7: 103,085,521 M1K probably null Het
Oplah T A 15: 76,297,347 probably benign Het
Ppp1r36 C A 12: 76,439,157 P363Q probably damaging Het
Rai1 C A 11: 60,190,521 H1804N possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf214 G A 9: 45,868,088 P455S probably damaging Het
Rnf220 T C 4: 117,277,612 T188A possibly damaging Het
S1pr4 C T 10: 81,499,323 V106M possibly damaging Het
Sall2 C A 14: 52,314,247 S495I probably benign Het
Sars2 A G 7: 28,744,258 E95G possibly damaging Het
Sema3f G A 9: 107,682,616 T693M probably damaging Het
Slfn2 C A 11: 83,069,576 T127K probably benign Het
Snrpe T A 1: 133,608,914 I43L probably benign Het
Srsf1 T C 11: 88,047,858 I7T possibly damaging Het
Ssbp1 T A 6: 40,476,903 probably benign Het
Stbd1 T G 5: 92,604,995 F115V probably benign Het
Stk11ip T A 1: 75,527,355 probably null Het
Taf1b T A 12: 24,500,525 N36K probably damaging Het
Tanc1 A T 2: 59,799,904 M743L probably benign Het
Tnfsf12 C A 11: 69,686,967 R208L probably damaging Het
Trafd1 T C 5: 121,373,471 D428G probably damaging Het
Trim24 A G 6: 37,957,729 E793G probably damaging Het
Tspan32 T C 7: 143,015,587 C100R probably damaging Het
Ttn T C 2: 76,746,242 D16442G probably damaging Het
Ube3c T A 5: 29,658,409 L894Q probably damaging Het
Wfs1 C G 5: 36,973,264 G213R probably damaging Het
Zfp384 G A 6: 125,024,099 A45T possibly damaging Het
Zfp865 G T 7: 5,031,087 K690N probably damaging Het
Other mutations in Pacsin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Pacsin2 APN 15 83386686 missense probably damaging 1.00
IGL02574:Pacsin2 APN 15 83388663 missense possibly damaging 0.81
R0153:Pacsin2 UTSW 15 83377661 missense probably benign 0.11
R0399:Pacsin2 UTSW 15 83386782 missense probably damaging 1.00
R0426:Pacsin2 UTSW 15 83379795 missense possibly damaging 0.90
R0799:Pacsin2 UTSW 15 83379797 missense probably benign 0.44
R0842:Pacsin2 UTSW 15 83379181 missense probably damaging 0.99
R1591:Pacsin2 UTSW 15 83385051 missense probably damaging 1.00
R2406:Pacsin2 UTSW 15 83385112 unclassified probably benign
R3906:Pacsin2 UTSW 15 83379055 missense probably damaging 1.00
R4686:Pacsin2 UTSW 15 83381775 missense probably benign 0.01
R4815:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
R6010:Pacsin2 UTSW 15 83381819 missense possibly damaging 0.87
R6152:Pacsin2 UTSW 15 83377699 missense probably damaging 1.00
R6367:Pacsin2 UTSW 15 83381832 missense probably benign
R6457:Pacsin2 UTSW 15 83379678 splice site probably null
R7158:Pacsin2 UTSW 15 83379742 missense possibly damaging 0.50
R7220:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
R8089:Pacsin2 UTSW 15 83379696 missense probably benign
X0027:Pacsin2 UTSW 15 83392602 missense probably benign 0.06
Z1177:Pacsin2 UTSW 15 83402001 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGCCTGTTCTCTACCAGC -3'
(R):5'- CTGGCAGAAGGTAAGTTAACACAC -3'

Sequencing Primer
(F):5'- TCTGCTCTCCTGGGCCAAG -3'
(R):5'- GGTAAGTTAACACACTTTTCTCCTG -3'
Posted On2017-02-10