Incidental Mutation 'R5860:Xpr1'
ID453814
Institutional Source Beutler Lab
Gene Symbol Xpr1
Ensembl Gene ENSMUSG00000026469
Gene Namexenotropic and polytropic retrovirus receptor 1
SynonymsRmc1, suppressor of yeast G deletion, Syg1, Rmc-1
MMRRC Submission 044072-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R5860 (G1)
Quality Score214
Status Validated
Chromosome1
Chromosomal Location155275701-155417415 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 155332122 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027741] [ENSMUST00000111774] [ENSMUST00000111775]
Predicted Effect probably benign
Transcript: ENSMUST00000027741
SMART Domains Protein: ENSMUSP00000027741
Gene: ENSMUSG00000026469

DomainStartEndE-ValueType
Pfam:SPX 1 174 1.4e-33 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 268 616 5.8e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111774
SMART Domains Protein: ENSMUSP00000107404
Gene: ENSMUSG00000026469

DomainStartEndE-ValueType
Pfam:SPX 1 176 1.5e-38 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 617 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111775
SMART Domains Protein: ENSMUSP00000107405
Gene: ENSMUSG00000026469

DomainStartEndE-ValueType
Pfam:SPX 1 176 4.5e-39 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 434 3.6e-45 PFAM
Pfam:EXS 432 552 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129271
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for the xenotropic and polytropic classes of murine leukemia viruses. The encoded protein is involved in phosphate homeostasis by mediating phosphate export from the cell. Defects in this gene have been associated with idiopathic basal ganglia calcification-6. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygotes and heterozygotes for a variant from some wild Mus stocks, including M. spretus, support replication of xenotropic murine leukemia viruses and mink cell focus-forming murine leukemia viruses that are not replicated in most laboratory strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Xpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Xpr1 APN 1 155290234 missense probably benign 0.00
IGL02657:Xpr1 APN 1 155290280 missense probably benign 0.05
IGL03077:Xpr1 APN 1 155281028 missense possibly damaging 0.58
R0019:Xpr1 UTSW 1 155332399 splice site probably benign
R0350:Xpr1 UTSW 1 155330468 missense probably damaging 1.00
R1299:Xpr1 UTSW 1 155417203 missense probably damaging 0.99
R1855:Xpr1 UTSW 1 155283256 missense probably benign
R2008:Xpr1 UTSW 1 155281029 unclassified probably null
R2071:Xpr1 UTSW 1 155290280 missense probably benign 0.05
R4293:Xpr1 UTSW 1 155312796 missense possibly damaging 0.91
R4509:Xpr1 UTSW 1 155290161 intron probably benign
R5060:Xpr1 UTSW 1 155328684 critical splice acceptor site probably null
R5527:Xpr1 UTSW 1 155290235 missense probably benign
R5586:Xpr1 UTSW 1 155312863 missense probably benign
R7565:Xpr1 UTSW 1 155307742 missense probably benign
R7729:Xpr1 UTSW 1 155312872 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCCCCAGCCCTAGATATGG -3'
(R):5'- GTGTCACGACATTGCGACAG -3'

Sequencing Primer
(F):5'- TGCCGAGTACTGGATTCAATC -3'
(R):5'- CAGCGCAGAAAGCCAGTGTTC -3'
Posted On2017-02-10