Incidental Mutation 'R5860:Atf6'
ID 453816
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms 9130025P16Rik, ESTM49, Atf6alpha
MMRRC Submission 044072-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R5860 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 170704674-170867771 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 170841775 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 119 (L119H)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably damaging
Transcript: ENSMUST00000027974
AA Change: L119H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: L119H

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170788606 critical splice donor site probably null
IGL01431:Atf6 APN 1 170853002 splice site probably benign
IGL01755:Atf6 APN 1 170788611 missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170819420 missense probably damaging 0.99
IGL02416:Atf6 APN 1 170747157 nonsense probably null
IGL02903:Atf6 APN 1 170799714 missense probably benign 0.00
IGL02989:Atf6 APN 1 170788683 splice site probably benign
IGL03209:Atf6 APN 1 170834894 missense probably benign
R0455:Atf6 UTSW 1 170834923 missense probably benign 0.00
R0467:Atf6 UTSW 1 170794020 missense probably damaging 1.00
R0491:Atf6 UTSW 1 170787344 critical splice donor site probably null
R0784:Atf6 UTSW 1 170709947 missense probably benign 0.19
R1486:Atf6 UTSW 1 170794691 missense probably damaging 1.00
R1850:Atf6 UTSW 1 170819286 missense probably damaging 1.00
R1945:Atf6 UTSW 1 170855141 missense probably benign 0.00
R2164:Atf6 UTSW 1 170794735 missense probably damaging 1.00
R3782:Atf6 UTSW 1 170794767 nonsense probably null
R4454:Atf6 UTSW 1 170794039 missense probably damaging 0.99
R4631:Atf6 UTSW 1 170747197 splice site probably null
R4676:Atf6 UTSW 1 170787410 missense probably damaging 1.00
R5772:Atf6 UTSW 1 170747189 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841776 missense possibly damaging 0.95
R5950:Atf6 UTSW 1 170834879 missense probably damaging 1.00
R6242:Atf6 UTSW 1 170793976 missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170867669 missense probably benign 0.00
R7032:Atf6 UTSW 1 170799612 critical splice donor site probably null
R7472:Atf6 UTSW 1 170815491 missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170794706 missense probably benign
R8002:Atf6 UTSW 1 170819254 missense probably benign 0.43
R8860:Atf6 UTSW 1 170852966 missense probably null 0.95
R8956:Atf6 UTSW 1 170794007 missense probably damaging 0.98
R9090:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9271:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9323:Atf6 UTSW 1 170855113 nonsense probably null
R9500:Atf6 UTSW 1 170747139 missense probably damaging 0.98
R9594:Atf6 UTSW 1 170840833 missense probably benign 0.18
R9733:Atf6 UTSW 1 170834833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCAAGTGGGCCTGGATTC -3'
(R):5'- GAGCGTTGACTTACCAATAGTCAC -3'

Sequencing Primer
(F):5'- AGCATGCACTTGGTTCACAG -3'
(R):5'- CTTACCAATAGTCACTTATACTGTGC -3'
Posted On 2017-02-10