Mutagenetix > Incidental Mutation

Incidental Mutation 'R5860:Atf6'

453817

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

044072-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R5860 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 170841776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 119 (L119F)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027974
AA Change: L119F

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: L119F

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Meta Mutation Damage Score

0.0870

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.8%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568A12Rik	A	G	1: 34,485,580		noncoding transcript	Het
A2ml1	T	C	6: 128,541,061	T1421A	probably benign	Het
Actr8	T	A	14: 29,986,285	Y150*	probably null	Het
Adamts1	A	G	16: 85,798,544	C249R	probably damaging	Het
Adgre1	T	A	17: 57,445,034	I594N	probably damaging	Het
B3gat2	G	A	1: 23,815,319	W33*	probably null	Het
Bach2	A	G	4: 32,580,268	D831G	probably damaging	Het
Ccnk	A	T	12: 108,187,207	I76F	probably damaging	Het
Cdyl	A	C	13: 35,858,083	K368T	possibly damaging	Het
Chil1	A	G	1: 134,185,171	T114A	probably benign	Het
Cnppd1	A	G	1: 75,136,487	V379A	probably benign	Het
Col11a2	C	A	17: 34,064,185		probably benign	Het
Creb3l1	T	C	2: 92,024,054	S18G	probably benign	Het
Crybg3	A	C	16: 59,565,269	D197E	probably damaging	Het
Cryga	T	C	1: 65,103,368		probably benign	Het
Cthrc1	T	C	15: 39,086,685	C146R	probably damaging	Het
Cyhr1	A	T	15: 76,648,191	I239N	probably damaging	Het
Cyhr1	T	C	15: 76,656,415	Y101C	probably damaging	Het
Cyp2c39	A	T	19: 39,536,826	D191V	probably damaging	Het
Dchs1	C	T	7: 105,772,035	A393T	probably damaging	Het
Dhx30	G	A	9: 110,084,577	T1126I	probably damaging	Het
Dock2	C	T	11: 34,256,562	G1345R	probably damaging	Het
Dsc1	T	C	18: 20,095,024	E425G	probably damaging	Het
Exosc8	C	T	3: 54,735,042		probably benign	Het
Fat1	C	T	8: 45,051,129	A4553V	probably benign	Het
Flnb	T	A	14: 7,931,135	L2119Q	probably damaging	Het
Fnbp4	T	A	2: 90,757,482	D401E	probably benign	Het
Glyctk	T	C	9: 106,155,707	E369G	possibly damaging	Het
Gm14149	C	A	2: 151,224,305		noncoding transcript	Het
Golga4	T	C	9: 118,558,106	L1432P	probably damaging	Het
Gtpbp4	A	T	13: 8,973,160	S623T	probably benign	Het
Insc	A	C	7: 114,791,148	S85R	probably damaging	Het
Lgr4	G	A	2: 109,991,151	R126H	probably damaging	Het
M1ap	T	A	6: 83,003,814	L227Q	probably damaging	Het
March7	T	C	2: 60,236,843	I569T	probably damaging	Het
Mbd1	C	A	18: 74,276,697	C339*	probably null	Het
Moxd2	T	A	6: 40,880,407	Y473F	probably damaging	Het
Mrgpra6	T	C	7: 47,189,351	H2R	probably benign	Het
Mtus1	T	G	8: 41,076,266	L742F	probably damaging	Het
Nek11	A	G	9: 105,392,961	Y21H	probably benign	Het
Notch4	G	T	17: 34,582,418	C1080F	probably damaging	Het
Nsd3	C	A	8: 25,666,091	P558Q	probably damaging	Het
Oas1e	A	T	5: 120,791,950	S168T	probably benign	Het
Ogfr	T	C	2: 180,592,492	S119P	probably damaging	Het
Olfr1387	A	G	11: 49,459,736	D19G	probably damaging	Het
Olfr44	T	A	9: 39,484,471	M261L	probably benign	Het
Pde4dip	A	G	3: 97,724,188	I1135T	possibly damaging	Het
Prex1	G	A	2: 166,644,684		probably benign	Het
Ptprf	T	C	4: 118,211,289		probably benign	Het
Rapsn	T	C	2: 91,045,514	V359A	probably damaging	Het
Ric1	A	G	19: 29,599,845	S1050G	possibly damaging	Het
Rnft2	A	G	5: 118,228,803	I290T	possibly damaging	Het
Senp7	C	A	16: 56,155,359	A476E	possibly damaging	Het
Serpinh1	G	A	7: 99,346,364	S337L	probably damaging	Het
Slc5a12	C	A	2: 110,597,624	A8D	probably benign	Het
Smg5	T	A	3: 88,342,907	C109S	probably damaging	Het
Speer4b	T	C	5: 27,500,228	H49R	possibly damaging	Het
Tas2r109	T	C	6: 132,980,701	I89V	probably benign	Het
Tctex1d2	A	G	16: 32,428,796	Y143C	probably damaging	Het
Tet1	A	G	10: 62,812,620		probably null	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Tpgs1	G	A	10: 79,669,711	G101D	probably damaging	Het
Trim13	T	G	14: 61,604,739	S68R	probably damaging	Het
Vwf	A	G	6: 125,643,090	N1577S		Het
Vwf	G	T	6: 125,679,265		probably benign	Het
Xpr1	T	C	1: 155,332,122		probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAAGTGGGCCTGGATTCTG -3'
(R):5'- TGAGCGTTGACTTACCAATAGTC -3'

Sequencing Primer
(F):5'- AGCATGCACTTGGTTCACAG -3'
(R):5'- CTTACCAATAGTCACTTATACTGTGC -3'

Posted On

2017-02-10