Mutagenetix > Incidental Mutation

Incidental Mutation 'R5860:Rapsn'

453820

Institutional Source

Beutler Lab

Gene Symbol

Rapsn

Ensembl Gene

ENSMUSG00000002104

Gene Name

receptor-associated protein of the synapse

Synonyms

Nraps, rapsyn, 43kDa acetylcholine receptor-associated protein, Raps

MMRRC Submission

044072-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5860 (G1)

Quality Score

171

Status

Validated

Chromosome

Chromosomal Location

91035620-91045729 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91045514 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 359 (V359A)

Ref Sequence

ENSEMBL: ENSMUSP00000107073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050323] [ENSMUST00000111445] [ENSMUST00000111446]

AlphaFold

P12672

Predicted Effect

probably damaging
Transcript: ENSMUST00000050323
AA Change: V412A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054150
Gene: ENSMUSG00000002104
AA Change: V412A

Domain	Start	End	E-Value	Type
TPR	6	39	5.62e1	SMART
Blast:TPR	43	74	2e-10	BLAST
TPR	83	116	2.56e1	SMART
TPR	123	156	1.11e-2	SMART
TPR	163	196	8.29e0	SMART
TPR	206	239	1.24e0	SMART
Blast:TPR	246	279	1e-14	BLAST
TPR	286	319	2.07e1	SMART
RING	363	402	2.67e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111445
AA Change: V353A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107072
Gene: ENSMUSG00000002104
AA Change: V353A

Domain	Start	End	E-Value	Type
TPR	6	39	5.62e1	SMART
Blast:TPR	43	74	1e-10	BLAST
TPR	83	116	2.56e1	SMART
TPR	123	156	1.11e-2	SMART
TPR	163	196	8.29e0	SMART
TPR	206	239	1.24e0	SMART
RING	304	343	2.67e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111446
AA Change: V359A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107073
Gene: ENSMUSG00000002104
AA Change: V359A

Domain	Start	End	E-Value	Type
TPR	6	39	5.62e1	SMART
Blast:TPR	43	74	1e-10	BLAST
TPR	83	116	2.56e1	SMART
TPR	123	156	1.11e-2	SMART
Blast:TPR	193	226	9e-15	BLAST
TPR	233	266	2.07e1	SMART
RING	310	349	2.67e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128008

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146633

Meta Mutation Damage Score

0.1378

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.8%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of acetylcholine receptor clusters at end plate band of neuromuscular synapses, muscle weakness, and respiratory distress leading to lethality within hours of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568A12Rik	A	G	1: 34,485,580		noncoding transcript	Het
A2ml1	T	C	6: 128,541,061	T1421A	probably benign	Het
Actr8	T	A	14: 29,986,285	Y150*	probably null	Het
Adamts1	A	G	16: 85,798,544	C249R	probably damaging	Het
Adgre1	T	A	17: 57,445,034	I594N	probably damaging	Het
Atf6	A	T	1: 170,841,775	L119H	probably damaging	Het
Atf6	G	A	1: 170,841,776	L119F	possibly damaging	Het
B3gat2	G	A	1: 23,815,319	W33*	probably null	Het
Bach2	A	G	4: 32,580,268	D831G	probably damaging	Het
Ccnk	A	T	12: 108,187,207	I76F	probably damaging	Het
Cdyl	A	C	13: 35,858,083	K368T	possibly damaging	Het
Chil1	A	G	1: 134,185,171	T114A	probably benign	Het
Cnppd1	A	G	1: 75,136,487	V379A	probably benign	Het
Col11a2	C	A	17: 34,064,185		probably benign	Het
Creb3l1	T	C	2: 92,024,054	S18G	probably benign	Het
Crybg3	A	C	16: 59,565,269	D197E	probably damaging	Het
Cryga	T	C	1: 65,103,368		probably benign	Het
Cthrc1	T	C	15: 39,086,685	C146R	probably damaging	Het
Cyhr1	A	T	15: 76,648,191	I239N	probably damaging	Het
Cyhr1	T	C	15: 76,656,415	Y101C	probably damaging	Het
Cyp2c39	A	T	19: 39,536,826	D191V	probably damaging	Het
Dchs1	C	T	7: 105,772,035	A393T	probably damaging	Het
Dhx30	G	A	9: 110,084,577	T1126I	probably damaging	Het
Dock2	C	T	11: 34,256,562	G1345R	probably damaging	Het
Dsc1	T	C	18: 20,095,024	E425G	probably damaging	Het
Exosc8	C	T	3: 54,735,042		probably benign	Het
Fat1	C	T	8: 45,051,129	A4553V	probably benign	Het
Flnb	T	A	14: 7,931,135	L2119Q	probably damaging	Het
Fnbp4	T	A	2: 90,757,482	D401E	probably benign	Het
Glyctk	T	C	9: 106,155,707	E369G	possibly damaging	Het
Gm14149	C	A	2: 151,224,305		noncoding transcript	Het
Golga4	T	C	9: 118,558,106	L1432P	probably damaging	Het
Gtpbp4	A	T	13: 8,973,160	S623T	probably benign	Het
Insc	A	C	7: 114,791,148	S85R	probably damaging	Het
Lgr4	G	A	2: 109,991,151	R126H	probably damaging	Het
M1ap	T	A	6: 83,003,814	L227Q	probably damaging	Het
March7	T	C	2: 60,236,843	I569T	probably damaging	Het
Mbd1	C	A	18: 74,276,697	C339*	probably null	Het
Moxd2	T	A	6: 40,880,407	Y473F	probably damaging	Het
Mrgpra6	T	C	7: 47,189,351	H2R	probably benign	Het
Mtus1	T	G	8: 41,076,266	L742F	probably damaging	Het
Nek11	A	G	9: 105,392,961	Y21H	probably benign	Het
Notch4	G	T	17: 34,582,418	C1080F	probably damaging	Het
Nsd3	C	A	8: 25,666,091	P558Q	probably damaging	Het
Oas1e	A	T	5: 120,791,950	S168T	probably benign	Het
Ogfr	T	C	2: 180,592,492	S119P	probably damaging	Het
Olfr1387	A	G	11: 49,459,736	D19G	probably damaging	Het
Olfr44	T	A	9: 39,484,471	M261L	probably benign	Het
Pde4dip	A	G	3: 97,724,188	I1135T	possibly damaging	Het
Prex1	G	A	2: 166,644,684		probably benign	Het
Ptprf	T	C	4: 118,211,289		probably benign	Het
Ric1	A	G	19: 29,599,845	S1050G	possibly damaging	Het
Rnft2	A	G	5: 118,228,803	I290T	possibly damaging	Het
Senp7	C	A	16: 56,155,359	A476E	possibly damaging	Het
Serpinh1	G	A	7: 99,346,364	S337L	probably damaging	Het
Slc5a12	C	A	2: 110,597,624	A8D	probably benign	Het
Smg5	T	A	3: 88,342,907	C109S	probably damaging	Het
Speer4b	T	C	5: 27,500,228	H49R	possibly damaging	Het
Tas2r109	T	C	6: 132,980,701	I89V	probably benign	Het
Tctex1d2	A	G	16: 32,428,796	Y143C	probably damaging	Het
Tet1	A	G	10: 62,812,620		probably null	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Tpgs1	G	A	10: 79,669,711	G101D	probably damaging	Het
Trim13	T	G	14: 61,604,739	S68R	probably damaging	Het
Vwf	A	G	6: 125,643,090	N1577S		Het
Vwf	G	T	6: 125,679,265		probably benign	Het
Xpr1	T	C	1: 155,332,122		probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Rapsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rapsn	APN	2	91035860	missense	probably damaging	1.00
IGL01386:Rapsn	APN	2	91036799	missense	probably damaging	1.00
IGL01517:Rapsn	APN	2	91036618	missense	probably damaging	1.00
IGL01707:Rapsn	APN	2	91043240	missense	probably benign	0.03
IGL02322:Rapsn	APN	2	91041906	missense	possibly damaging	0.80
IGL02800:Rapsn	APN	2	91043239	missense	probably benign
hermitage	UTSW	2	91036827	missense	probably damaging	1.00
rasputin	UTSW	2	91035924	missense	probably damaging	1.00
tsarina	UTSW	2	91045514	missense	probably damaging	1.00
R0744:Rapsn	UTSW	2	91036808	missense	probably damaging	0.99
R0833:Rapsn	UTSW	2	91036808	missense	probably damaging	0.99
R0836:Rapsn	UTSW	2	91036808	missense	probably damaging	0.99
R1224:Rapsn	UTSW	2	91043198	missense	probably damaging	1.00
R1294:Rapsn	UTSW	2	91036775	nonsense	probably null
R1619:Rapsn	UTSW	2	91043159	missense	possibly damaging	0.84
R2891:Rapsn	UTSW	2	91036824	missense	probably damaging	0.98
R2892:Rapsn	UTSW	2	91036824	missense	probably damaging	0.98
R2893:Rapsn	UTSW	2	91036824	missense	probably damaging	0.98
R4135:Rapsn	UTSW	2	91036817	missense	probably damaging	0.99
R4515:Rapsn	UTSW	2	91043212	missense	possibly damaging	0.91
R5689:Rapsn	UTSW	2	91035924	missense	probably damaging	1.00
R5953:Rapsn	UTSW	2	91041963	missense	probably benign	0.04
R6495:Rapsn	UTSW	2	91036628	missense	probably damaging	1.00
R7644:Rapsn	UTSW	2	91041954	missense	possibly damaging	0.80
R7775:Rapsn	UTSW	2	91044948	missense	probably benign	0.02
R7778:Rapsn	UTSW	2	91044948	missense	probably benign	0.02
R7896:Rapsn	UTSW	2	91044955	missense	probably benign	0.06
R9016:Rapsn	UTSW	2	91036827	missense	probably damaging	1.00
R9118:Rapsn	UTSW	2	91045033	missense	probably damaging	1.00
R9643:Rapsn	UTSW	2	91041923	missense	probably damaging	1.00
R9746:Rapsn	UTSW	2	91045478	missense	probably damaging	1.00
R9748:Rapsn	UTSW	2	91045478	missense	probably damaging	1.00
X0064:Rapsn	UTSW	2	91043003	missense	probably benign	0.14
Z1176:Rapsn	UTSW	2	91036598	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TAGACAGTGACCTCCTCGTC -3'
(R):5'- AAGGGTCAGAATCACTAGCAC -3'

Sequencing Primer
(F):5'- AGTGACCTCCTCGTCTGGAAG -3'
(R):5'- GGTCAGAATCACTAGCACCAGGTAC -3'

Posted On

2017-02-10