Mutagenetix > Incidental Mutation

Incidental Mutation 'R5860:Pde4dip'

453830

Institutional Source

Beutler Lab

Gene Symbol

Pde4dip

Ensembl Gene

ENSMUSG00000038170

Gene Name

phosphodiesterase 4D interacting protein (myomegalin)

Synonyms

D130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik

MMRRC Submission

044072-MU

Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5860 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97689824-97888707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97724188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1135 (I1135T)

Ref Sequence

ENSEMBL: ENSMUSP00000088254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090750
AA Change: I1135T

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: I1135T

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Cnn_1N	124	196	3.2e-26	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	4.03e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	6.59e-5	PROSPERO
internal_repeat_1	620	661	4.03e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	6.59e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1780	N/A	INTRINSIC
low complexity region	1836	1851	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
low complexity region	1940	1951	N/A	INTRINSIC
coiled coil region	1962	2138	N/A	INTRINSIC
coiled coil region	2162	2197	N/A	INTRINSIC
coiled coil region	2387	2431	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168438
AA Change: I1135T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: I1135T

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Microtub_assoc	124	198	1.4e-31	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	3.56e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	5.83e-5	PROSPERO
internal_repeat_1	620	661	3.56e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	5.83e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1769	N/A	INTRINSIC
low complexity region	1785	1800	N/A	INTRINSIC
low complexity region	1809	1823	N/A	INTRINSIC
low complexity region	1889	1900	N/A	INTRINSIC
coiled coil region	1911	2087	N/A	INTRINSIC
coiled coil region	2111	2146	N/A	INTRINSIC
coiled coil region	2336	2380	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.8%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568A12Rik	A	G	1: 34,485,580		noncoding transcript	Het
A2ml1	T	C	6: 128,541,061	T1421A	probably benign	Het
Actr8	T	A	14: 29,986,285	Y150*	probably null	Het
Adamts1	A	G	16: 85,798,544	C249R	probably damaging	Het
Adgre1	T	A	17: 57,445,034	I594N	probably damaging	Het
Atf6	A	T	1: 170,841,775	L119H	probably damaging	Het
Atf6	G	A	1: 170,841,776	L119F	possibly damaging	Het
B3gat2	G	A	1: 23,815,319	W33*	probably null	Het
Bach2	A	G	4: 32,580,268	D831G	probably damaging	Het
Ccnk	A	T	12: 108,187,207	I76F	probably damaging	Het
Cdyl	A	C	13: 35,858,083	K368T	possibly damaging	Het
Chil1	A	G	1: 134,185,171	T114A	probably benign	Het
Cnppd1	A	G	1: 75,136,487	V379A	probably benign	Het
Col11a2	C	A	17: 34,064,185		probably benign	Het
Creb3l1	T	C	2: 92,024,054	S18G	probably benign	Het
Crybg3	A	C	16: 59,565,269	D197E	probably damaging	Het
Cryga	T	C	1: 65,103,368		probably benign	Het
Cthrc1	T	C	15: 39,086,685	C146R	probably damaging	Het
Cyhr1	A	T	15: 76,648,191	I239N	probably damaging	Het
Cyhr1	T	C	15: 76,656,415	Y101C	probably damaging	Het
Cyp2c39	A	T	19: 39,536,826	D191V	probably damaging	Het
Dchs1	C	T	7: 105,772,035	A393T	probably damaging	Het
Dhx30	G	A	9: 110,084,577	T1126I	probably damaging	Het
Dock2	C	T	11: 34,256,562	G1345R	probably damaging	Het
Dsc1	T	C	18: 20,095,024	E425G	probably damaging	Het
Exosc8	C	T	3: 54,735,042		probably benign	Het
Fat1	C	T	8: 45,051,129	A4553V	probably benign	Het
Flnb	T	A	14: 7,931,135	L2119Q	probably damaging	Het
Fnbp4	T	A	2: 90,757,482	D401E	probably benign	Het
Glyctk	T	C	9: 106,155,707	E369G	possibly damaging	Het
Gm14149	C	A	2: 151,224,305		noncoding transcript	Het
Golga4	T	C	9: 118,558,106	L1432P	probably damaging	Het
Gtpbp4	A	T	13: 8,973,160	S623T	probably benign	Het
Insc	A	C	7: 114,791,148	S85R	probably damaging	Het
Lgr4	G	A	2: 109,991,151	R126H	probably damaging	Het
M1ap	T	A	6: 83,003,814	L227Q	probably damaging	Het
March7	T	C	2: 60,236,843	I569T	probably damaging	Het
Mbd1	C	A	18: 74,276,697	C339*	probably null	Het
Moxd2	T	A	6: 40,880,407	Y473F	probably damaging	Het
Mrgpra6	T	C	7: 47,189,351	H2R	probably benign	Het
Mtus1	T	G	8: 41,076,266	L742F	probably damaging	Het
Nek11	A	G	9: 105,392,961	Y21H	probably benign	Het
Notch4	G	T	17: 34,582,418	C1080F	probably damaging	Het
Nsd3	C	A	8: 25,666,091	P558Q	probably damaging	Het
Oas1e	A	T	5: 120,791,950	S168T	probably benign	Het
Ogfr	T	C	2: 180,592,492	S119P	probably damaging	Het
Olfr1387	A	G	11: 49,459,736	D19G	probably damaging	Het
Olfr44	T	A	9: 39,484,471	M261L	probably benign	Het
Prex1	G	A	2: 166,644,684		probably benign	Het
Ptprf	T	C	4: 118,211,289		probably benign	Het
Rapsn	T	C	2: 91,045,514	V359A	probably damaging	Het
Ric1	A	G	19: 29,599,845	S1050G	possibly damaging	Het
Rnft2	A	G	5: 118,228,803	I290T	possibly damaging	Het
Senp7	C	A	16: 56,155,359	A476E	possibly damaging	Het
Serpinh1	G	A	7: 99,346,364	S337L	probably damaging	Het
Slc5a12	C	A	2: 110,597,624	A8D	probably benign	Het
Smg5	T	A	3: 88,342,907	C109S	probably damaging	Het
Speer4b	T	C	5: 27,500,228	H49R	possibly damaging	Het
Tas2r109	T	C	6: 132,980,701	I89V	probably benign	Het
Tctex1d2	A	G	16: 32,428,796	Y143C	probably damaging	Het
Tet1	A	G	10: 62,812,620		probably null	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Tpgs1	G	A	10: 79,669,711	G101D	probably damaging	Het
Trim13	T	G	14: 61,604,739	S68R	probably damaging	Het
Vwf	A	G	6: 125,643,090	N1577S		Het
Vwf	G	T	6: 125,679,265		probably benign	Het
Xpr1	T	C	1: 155,332,122		probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Pde4dip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Pde4dip	APN	3	97767277	missense	probably benign	0.00
IGL00543:Pde4dip	APN	3	97757624	missense	possibly damaging	0.91
IGL00979:Pde4dip	APN	3	97747758	splice site	probably benign
IGL01483:Pde4dip	APN	3	97754149	missense	probably damaging	1.00
IGL02122:Pde4dip	APN	3	97767421	missense	probably damaging	1.00
IGL02398:Pde4dip	APN	3	97766781	missense	probably benign
IGL02814:Pde4dip	APN	3	97767100	missense	probably damaging	1.00
IGL02826:Pde4dip	APN	3	97767087	missense	probably damaging	1.00
D3080:Pde4dip	UTSW	3	97766830	missense	probably damaging	1.00
R0077:Pde4dip	UTSW	3	97753126	nonsense	probably null
R0096:Pde4dip	UTSW	3	97767467	missense	probably damaging	0.99
R0277:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0304:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0616:Pde4dip	UTSW	3	97747533	missense	probably benign	0.09
R0676:Pde4dip	UTSW	3	97717097	splice site	probably benign
R1166:Pde4dip	UTSW	3	97713196	missense	possibly damaging	0.94
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1452:Pde4dip	UTSW	3	97724102	missense	probably damaging	1.00
R1550:Pde4dip	UTSW	3	97719704	missense	probably damaging	1.00
R1700:Pde4dip	UTSW	3	97703323	missense	probably benign	0.00
R1704:Pde4dip	UTSW	3	97754260	missense	probably benign	0.28
R1769:Pde4dip	UTSW	3	97695930	missense	probably benign	0.00
R1934:Pde4dip	UTSW	3	97692691	missense	possibly damaging	0.74
R1980:Pde4dip	UTSW	3	97756996	missense	possibly damaging	0.93
R2088:Pde4dip	UTSW	3	97754433	missense	probably null	1.00
R2143:Pde4dip	UTSW	3	97888519	missense	possibly damaging	0.86
R2149:Pde4dip	UTSW	3	97792836	missense	possibly damaging	0.64
R2156:Pde4dip	UTSW	3	97724218	missense	probably damaging	0.98
R2158:Pde4dip	UTSW	3	97757621	missense	probably benign	0.15
R2240:Pde4dip	UTSW	3	97724164	missense	probably benign	0.00
R2249:Pde4dip	UTSW	3	97793525	missense	probably damaging	1.00
R2256:Pde4dip	UTSW	3	97718184	missense	probably damaging	1.00
R2680:Pde4dip	UTSW	3	97701617	missense	possibly damaging	0.92
R2921:Pde4dip	UTSW	3	97719569	missense	probably benign
R3407:Pde4dip	UTSW	3	97754468	missense	probably damaging	1.00
R3736:Pde4dip	UTSW	3	97724111	missense	probably damaging	1.00
R3787:Pde4dip	UTSW	3	97715552	missense	possibly damaging	0.80
R3883:Pde4dip	UTSW	3	97713188	missense	probably damaging	1.00
R4437:Pde4dip	UTSW	3	97766569	missense	possibly damaging	0.52
R4528:Pde4dip	UTSW	3	97717022	missense	probably damaging	1.00
R4576:Pde4dip	UTSW	3	97754249	missense	probably damaging	1.00
R4600:Pde4dip	UTSW	3	97695944	missense	probably damaging	0.98
R4653:Pde4dip	UTSW	3	97767338	missense	probably damaging	0.99
R4678:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4679:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4688:Pde4dip	UTSW	3	97843677	nonsense	probably null
R4770:Pde4dip	UTSW	3	97767084	missense	probably damaging	1.00
R4841:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4842:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4899:Pde4dip	UTSW	3	97709558	missense	probably damaging	1.00
R4914:Pde4dip	UTSW	3	97715328	missense	probably benign	0.10
R4943:Pde4dip	UTSW	3	97755511	missense	probably damaging	0.99
R5131:Pde4dip	UTSW	3	97709514	missense	probably damaging	0.98
R5408:Pde4dip	UTSW	3	97796736	missense	probably benign	0.35
R5583:Pde4dip	UTSW	3	97747576	missense	possibly damaging	0.67
R5677:Pde4dip	UTSW	3	97841648	nonsense	probably null
R5689:Pde4dip	UTSW	3	97692367	nonsense	probably null
R5696:Pde4dip	UTSW	3	97709490	missense	probably damaging	1.00
R6279:Pde4dip	UTSW	3	97699180	missense	probably damaging	1.00
R6341:Pde4dip	UTSW	3	97694911	missense	probably benign
R6440:Pde4dip	UTSW	3	97767586	missense	probably damaging	1.00
R6464:Pde4dip	UTSW	3	97710344	missense	probably damaging	1.00
R6489:Pde4dip	UTSW	3	97755591	nonsense	probably null
R6706:Pde4dip	UTSW	3	97741393	missense	probably damaging	1.00
R6722:Pde4dip	UTSW	3	97718239	nonsense	probably null
R6798:Pde4dip	UTSW	3	97888534	missense	probably benign
R6804:Pde4dip	UTSW	3	97793248	nonsense	probably null
R6862:Pde4dip	UTSW	3	97767024	missense	possibly damaging	0.52
R6957:Pde4dip	UTSW	3	97824333	splice site	probably null
R6983:Pde4dip	UTSW	3	97718236	missense	probably damaging	1.00
R7014:Pde4dip	UTSW	3	97715422	missense	possibly damaging	0.54
R7025:Pde4dip	UTSW	3	97724183	nonsense	probably null
R7136:Pde4dip	UTSW	3	97694063	missense	probably benign	0.03
R7178:Pde4dip	UTSW	3	97715630	missense	probably benign	0.26
R7269:Pde4dip	UTSW	3	97766959	missense	probably damaging	1.00
R7283:Pde4dip	UTSW	3	97758882	missense	probably benign	0.03
R7354:Pde4dip	UTSW	3	97719330	missense	probably damaging	0.99
R7357:Pde4dip	UTSW	3	97715541	missense	probably benign	0.01
R7360:Pde4dip	UTSW	3	97718316	missense	probably benign	0.01
R7371:Pde4dip	UTSW	3	97757271	missense	probably benign	0.08
R7432:Pde4dip	UTSW	3	97695092	missense	probably benign
R7536:Pde4dip	UTSW	3	97757244	missense	probably damaging	1.00
R7542:Pde4dip	UTSW	3	97766655	missense	possibly damaging	0.59
R7609:Pde4dip	UTSW	3	97715565	missense	possibly damaging	0.85
R7650:Pde4dip	UTSW	3	97699107	critical splice donor site	probably null
R7800:Pde4dip	UTSW	3	97715283	missense	probably damaging	1.00
R7846:Pde4dip	UTSW	3	97715174	missense	probably damaging	1.00
R7918:Pde4dip	UTSW	3	97715223	nonsense	probably null
R8120:Pde4dip	UTSW	3	97706938	missense	probably null	0.94
R8139:Pde4dip	UTSW	3	97696993	missense	probably benign	0.02
R8144:Pde4dip	UTSW	3	97715426	missense	probably damaging	1.00
R8177:Pde4dip	UTSW	3	97767532	missense	probably damaging	0.98
R8294:Pde4dip	UTSW	3	97767378	missense	probably damaging	1.00
R8406:Pde4dip	UTSW	3	97699112	missense	probably benign	0.04
R8911:Pde4dip	UTSW	3	97743601	missense	probably benign	0.22
R8912:Pde4dip	UTSW	3	97710317	missense	probably damaging	1.00
R8960:Pde4dip	UTSW	3	97793148	missense	probably damaging	1.00
R8993:Pde4dip	UTSW	3	97766494	missense	probably damaging	1.00
R9031:Pde4dip	UTSW	3	97692359	missense	probably damaging	1.00
R9032:Pde4dip	UTSW	3	97694069	missense	probably benign	0.00
R9085:Pde4dip	UTSW	3	97694069	missense	probably benign	0.00
R9103:Pde4dip	UTSW	3	97841728	missense	probably damaging	1.00
R9163:Pde4dip	UTSW	3	97751807	critical splice donor site	probably null
R9182:Pde4dip	UTSW	3	97694998	missense	probably benign	0.13
R9185:Pde4dip	UTSW	3	97758816	missense	probably benign	0.01
R9286:Pde4dip	UTSW	3	97699867	missense	probably damaging	1.00
R9357:Pde4dip	UTSW	3	97718329	missense	probably benign	0.00
R9415:Pde4dip	UTSW	3	97753152	missense	possibly damaging	0.82
R9500:Pde4dip	UTSW	3	97888580	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGCCTGTGTTGTGGATGACC -3'
(R):5'- GGAGCTGCCCTTTCTTGTGATC -3'

Sequencing Primer
(F):5'- TGGATGACCCTGGTGAAGCAC -3'
(R):5'- ATCTTGGGTGAACTCCAGTGGC -3'

Posted On

2017-02-10