Incidental Mutation 'R5860:Ptprf'
ID453832
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission 044072-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R5860 (G1)
Quality Score118
Status Validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 118211289 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074]
Predicted Effect probably benign
Transcript: ENSMUST00000049074
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123484
Predicted Effect probably benign
Transcript: ENSMUST00000124758
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127616
Predicted Effect probably benign
Transcript: ENSMUST00000150096
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184953
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118213612 missense probably damaging 1.00
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R1860:Ptprf UTSW 4 118223932 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118211022 missense probably benign 0.16
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R4857:Ptprf UTSW 4 118217197 splice site probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5356:Ptprf UTSW 4 118226338 missense probably benign 0.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118224924 missense probably damaging 1.00
R5693:Ptprf UTSW 4 118236177 nonsense probably null
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6088:Ptprf UTSW 4 118210755 missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense probably damaging 1.00
R7326:Ptprf UTSW 4 118231669 missense probably damaging 0.99
R7337:Ptprf UTSW 4 118211125 missense probably damaging 0.99
R7374:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R7375:Ptprf UTSW 4 118212814 missense probably benign
R7399:Ptprf UTSW 4 118226523 missense probably benign 0.28
R7417:Ptprf UTSW 4 118212172 missense probably damaging 1.00
R7448:Ptprf UTSW 4 118235667 missense probably benign 0.03
R7530:Ptprf UTSW 4 118212748 missense probably damaging 1.00
R7593:Ptprf UTSW 4 118212396 missense probably benign 0.00
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Z1177:Ptprf UTSW 4 118269615 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTTCTCCTGTGGACAGAACACC -3'
(R):5'- AGCACCTCCATCATGTGAAGTC -3'

Sequencing Primer
(F):5'- TGTGGACAGAACACCAGGCAC -3'
(R):5'- CATGTGAAGTCTTATGTCACCCAG -3'
Posted On2017-02-10