Incidental Mutation 'R5860:Mtus1'
ID453847
Institutional Source Beutler Lab
Gene Symbol Mtus1
Ensembl Gene ENSMUSG00000045636
Gene Namemitochondrial tumor suppressor 1
SynonymsB430305I03Rik, MD44, MTSG1, Atip1
MMRRC Submission 044072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R5860 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40990914-41133726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 41076266 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 742 (L742F)
Ref Sequence ENSEMBL: ENSMUSP00000119440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059115] [ENSMUST00000118835] [ENSMUST00000145860]
Predicted Effect probably benign
Transcript: ENSMUST00000059115
AA Change: L742F

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059503
Gene: ENSMUSG00000045636
AA Change: L742F

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118835
AA Change: L742F

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112626
Gene: ENSMUSG00000045636
AA Change: L742F

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000143853
AA Change: L108F
Predicted Effect probably damaging
Transcript: ENSMUST00000145860
AA Change: L742F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119440
Gene: ENSMUSG00000045636
AA Change: L742F

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit spontaneous heart hypertrophy and SLE-like lymphoproliferative disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Mtus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mtus1 APN 8 41084349 missense probably damaging 1.00
IGL01377:Mtus1 APN 8 41083135 missense possibly damaging 0.94
IGL01472:Mtus1 APN 8 41002412 missense probably benign 0.01
IGL01995:Mtus1 APN 8 41084420 missense probably damaging 1.00
IGL02027:Mtus1 APN 8 40993601 missense probably damaging 1.00
IGL02381:Mtus1 APN 8 41083119 missense probably benign 0.05
IGL02571:Mtus1 APN 8 41083482 missense possibly damaging 0.90
IGL02936:Mtus1 APN 8 40999517 missense possibly damaging 0.79
R0116:Mtus1 UTSW 8 40998477 unclassified probably benign
R0139:Mtus1 UTSW 8 41016196 splice site probably benign
R0178:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0179:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0220:Mtus1 UTSW 8 40994572 missense probably damaging 1.00
R0324:Mtus1 UTSW 8 41084395 missense probably benign
R0355:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R0357:Mtus1 UTSW 8 41083526 missense possibly damaging 0.71
R0464:Mtus1 UTSW 8 41002474 missense probably damaging 0.96
R0681:Mtus1 UTSW 8 40993517 missense probably damaging 1.00
R1016:Mtus1 UTSW 8 41050026 missense probably benign 0.43
R1570:Mtus1 UTSW 8 41076241 missense probably damaging 1.00
R1579:Mtus1 UTSW 8 41082858 missense probably damaging 1.00
R1607:Mtus1 UTSW 8 41015409 missense possibly damaging 0.58
R1869:Mtus1 UTSW 8 41076230 critical splice donor site probably null
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1891:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1894:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R2063:Mtus1 UTSW 8 41082708 missense probably damaging 1.00
R2111:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2112:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2224:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2226:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2227:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2516:Mtus1 UTSW 8 41082739 missense probably damaging 1.00
R3414:Mtus1 UTSW 8 41048063 missense probably damaging 1.00
R3899:Mtus1 UTSW 8 41083129 missense probably benign
R4096:Mtus1 UTSW 8 41084247 missense probably damaging 0.99
R4831:Mtus1 UTSW 8 41083152 missense probably damaging 1.00
R4850:Mtus1 UTSW 8 41084470 missense possibly damaging 0.81
R4916:Mtus1 UTSW 8 41000801 missense probably damaging 1.00
R4940:Mtus1 UTSW 8 41041478 missense possibly damaging 0.52
R4988:Mtus1 UTSW 8 41084541 missense probably benign 0.05
R5133:Mtus1 UTSW 8 41083192 missense probably benign 0.00
R5468:Mtus1 UTSW 8 41084578 missense probably benign 0.00
R5598:Mtus1 UTSW 8 41022555 missense probably damaging 1.00
R5782:Mtus1 UTSW 8 41082727 missense probably damaging 1.00
R5900:Mtus1 UTSW 8 41083497 missense possibly damaging 0.92
R5943:Mtus1 UTSW 8 41084265 missense probably benign 0.00
R6019:Mtus1 UTSW 8 41083040 missense probably benign 0.33
R6125:Mtus1 UTSW 8 41084539 missense probably damaging 0.99
R6197:Mtus1 UTSW 8 41084037 missense possibly damaging 0.90
R6488:Mtus1 UTSW 8 41041508 missense possibly damaging 0.52
R6869:Mtus1 UTSW 8 41082654 missense possibly damaging 0.71
R7117:Mtus1 UTSW 8 41083584 missense possibly damaging 0.95
R7126:Mtus1 UTSW 8 41015402 missense probably damaging 0.98
R7213:Mtus1 UTSW 8 41084487 missense probably damaging 0.99
R7308:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R7424:Mtus1 UTSW 8 41022406 missense probably damaging 1.00
R7481:Mtus1 UTSW 8 41084615 missense probably damaging 0.99
R7485:Mtus1 UTSW 8 41084553 missense probably benign 0.37
R7660:Mtus1 UTSW 8 41016211 missense probably benign
R7699:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7700:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7709:Mtus1 UTSW 8 41054650 missense possibly damaging 0.81
R7791:Mtus1 UTSW 8 41083380 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAAGAGGCTGTGCTGTCTCC -3'
(R):5'- CTGGTTTGTTTCCTCACAGGGC -3'

Sequencing Primer
(F):5'- GTTGGACCACAATAAGCTCGCTG -3'
(R):5'- GGGCTCTGCACCCAAAACTTC -3'
Posted On2017-02-10