Incidental Mutation 'R5860:Olfr44'
ID453850
Institutional Source Beutler Lab
Gene Symbol Olfr44
Ensembl Gene ENSMUSG00000062649
Gene Nameolfactory receptor 44
SynonymsGA_x6K02T2PVTD-33181773-33180838, MOR171-5, IB3
MMRRC Submission 044072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5860 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39481786-39493995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39484471 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 261 (M261L)
Ref Sequence ENSEMBL: ENSMUSP00000076935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077757] [ENSMUST00000215065] [ENSMUST00000216316]
Predicted Effect probably benign
Transcript: ENSMUST00000077757
AA Change: M261L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076935
Gene: ENSMUSG00000062649
AA Change: M261L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.1e-50 PFAM
Pfam:7tm_1 44 293 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215065
AA Change: M258L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216316
AA Change: M258L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Olfr44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr44 APN 9 39484648 missense probably benign 0.02
IGL02239:Olfr44 APN 9 39484561 missense probably damaging 1.00
IGL02305:Olfr44 APN 9 39485037 missense probably damaging 0.97
IGL02353:Olfr44 APN 9 39485148 missense probably benign
IGL02360:Olfr44 APN 9 39485148 missense probably benign
R0212:Olfr44 UTSW 9 39485088 missense probably damaging 1.00
R0600:Olfr44 UTSW 9 39484988 missense probably benign 0.34
R1329:Olfr44 UTSW 9 39484444 missense probably damaging 0.97
R1348:Olfr44 UTSW 9 39485236 missense probably benign
R1594:Olfr44 UTSW 9 39484746 missense probably benign 0.03
R5017:Olfr44 UTSW 9 39484755 missense possibly damaging 0.90
R5141:Olfr44 UTSW 9 39484531 missense probably damaging 1.00
R5244:Olfr44 UTSW 9 39484512 missense probably damaging 1.00
R5524:Olfr44 UTSW 9 39484987 missense probably damaging 0.97
R5630:Olfr44 UTSW 9 39484951 missense probably benign 0.00
R6444:Olfr44 UTSW 9 39484318 missense probably benign 0.04
R6649:Olfr44 UTSW 9 39484752 missense probably benign 0.02
R6653:Olfr44 UTSW 9 39484752 missense probably benign 0.02
R7115:Olfr44 UTSW 9 39484648 missense probably benign 0.02
R7595:Olfr44 UTSW 9 39484315 missense probably benign 0.05
R7791:Olfr44 UTSW 9 39484881 missense probably damaging 1.00
R8054:Olfr44 UTSW 9 39484737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTGTTGACTCTGTGAAAC -3'
(R):5'- TTTGGGACACTGAACATCTTTG -3'

Sequencing Primer
(F):5'- TGTTGACTCTGTGAAACAATATGG -3'
(R):5'- GGACACTGAACATCTTTGTCCCAATC -3'
Posted On2017-02-10